FC09CC10

FC09CC10

 

3

 

ORF1

 

EFC7840953B447F3

 

88

 

IPR004217

 

SEQUENCE: FC09CC10_3_ORF1CRC64: EFC7840953B447F3LENGTH: 88 aa
InterPro
IPR004217
Family
Zinc finger, Tim10/DDP-type
PF02953[23-87]T 1.1e-30 PF02953 zf-Tim10_DDPzf-Tim10_DDP
noIPR
unintegrated
unintegrated
PTHR19338[1-88]T 7.8e-50 PTHR19338 FAMILY NOT NAMEDFAMILY NOT NAMED
PTHR19338:SF3[1-88]T 7.8e-50 PTHR19338:SF3 SUBFAMILY NOT NAMEDSUBFAMILY NOT NAMED
seg[55-67]? NA seg segseg

 

chr08_finished_C08HBa0201M14.1.v1.seq_C08HBa0201M14.1

 

100.0

 

122

 

0

 

0

 

1

 

122

 

138790

 

138669

 

1E-63

 

242.0

 

AK224710

 

atatggattctttttcgtcgccgccgccgcatagtggagcatcctcccaattctcgactaatgacataatggaccaggtcaaaactcagcttgaacaggcatacgccgagcaatttctcgagacggtgagggacaaatgctttgacaagtgtatcaccaaaccagggagcagtctaagtggaagtgaaggtagttgcatctcaaggtgtgttgatcggtatatcgaggccactggtataattagcaaagctctcttcagtcaacgctgaaactgtagttgggtagatctcaaggcttgcttgctcagtaaatgctggaatgcattaattaatctttgataccctttgtcattttccgttttaaagaaggttctcaagtattttgtaaaagatgttcttcattaatactttgttgttgatggacagccaaattttttttttatctatagcgtactattaagatttaaaaaaaaaa

 

37