FC08DF08

FC08DF08

 

1

 

ORF1

 

1CB7CEEA579319BC

 

116

 

IPR003496

 

SEQUENCE: FC08DF08_1_ORF1CRC64: 1CB7CEEA579319BCLENGTH: 116 aa
InterPro
IPR003496
Family
ABA/WDS induced protein
PF02496[29-82]T 9e-28 PF02496 ABA_WDSABA_WDS
noIPR
unintegrated
unintegrated
PD007146[22-42]T 2e-06 PD007146 Q7XYV7_LYCCI_Q7XYV7;Q7XYV7_LYCCI_Q7XYV7;
seg[5-21]? NA seg seg[43-63]? NA seg seg[66-115]? NA seg segseg

 

chr02_finished_C02SLm0014P22.1.v1.seq_C02SLm0014P22.1

 

100.0

 

42

 

0

 

0

 

510

 

551

 

60035

 

60076

 

8E-16

 

83.8

 

AK224695

 

tacaatatggctgaagagaaacaccaacaccatcaccatttgttccaccacaagaacaaggaggatgagggtggaccagttgattatgaaaaagaagtgaagcaccacagccatctcgagaagattggtgaacttggtgctgttgctgctggtgctttggccttacatgagaaacacaaggcaaagaaggacccagagcatgcacacaagcacaagatagaggaagagattgcagctgttgctgcagttggggcaggtggatttgcattccatgaacatcatcagaaaaaagatgccaagaaagaaaaaaaggaagttgagggtggacaccaccaccaccaccactactaatcaaatttaacttttttaggcacctatggactctatgttttgtctaatataaataaataaaagatactactatatatgtgttttgtatccaatattaatctctctctagattgtatgatttggtgtttctatgttaatctcactatgtaatactttgagcccgtttggatgggcttaataaaagcagctttaaaaaagtaaaaaaaaaa

 

35