LEFL1092CD12

LEFL1092CD12

 

1

 

ORF3

 

40F4420D2E645836

 

50

 

IPR000215

 

SEQUENCE: LEFL1092CD12_1_ORF3CRC64: 40F4420D2E645836LENGTH: 50 aa
InterPro
IPR000215
Family
Proteinase inhibitor I4, serpin
PS00284[37-47]? NA PS00284 SERPINSERPIN

 

chr04_finished_C04HBa0031H05.1.v1.seq_C04HBa0031H05.1

 

84.5

 

129

 

18

 

1

 

1116

 

1244

 

158970

 

158844

 

8E-18

 

91.7

 

AK247688

 

attctcattctcttcctctcctctctcactcggttgcctctccccctctctatactcctccagctggtgaagaccggcggaccagcaacaactttggtgaggctagcagccgttggccgcctcggcttcttcctctttctctcccttctccctccctcttcttatcttcctctccaggcgaggagcagtagcagccgataccatcggcatcttctgcagaaactaccaaacagaccgccggtagcagcaaatgcgaaggcgtaactctctctccaccttcctcttcttttttattctcctctctttgctggaccaccaccaccaccagtgcaacgagcaacccaacaacatcaacaacaacaactccngtgaaggaggaagttgcatgaggccagtgacgacaacagaaaacagcaatgtccccaaccaagcgaagctctgacaaaaactgccttctccaccagcagctccggccatggaacttcagtgagggccgagtttaaatatgaagatggcagatctcaacagatccgtccggatccgtcatttctcccgccatggagcgcttatccacttggttttttctgtgttcgggcctatatcgaatcaaattgggtcttcactgctgataaataataaggaaagatgtccaagtttgaaaatgcacaaggcatatagaaaaaagtgcagatttgcgacctacgaaggccatcgatggacagtaggtgttgacaattgatggtagttcaaggctaaaggagaagatcagggagatttgactaagtgtataaccacgagagtaaacgatgatccttatattgatcaacggaccgtactggtgaactatcaattggtttagtgaaggttctagtacctgactttttcaagattctatgtatggaacgacagaagagcatcgatggggtgtagatgaatcgacggaccgtattgctggtacgtcatttgatttagagaaggtgttggccagtgaagaaaaattattccaagtatggactgacgaggaaatcgatgaatcgtcgttccattgacagttctacagcgagatctttgtttgaattcgtgtttttggacaaaacttttcttattttatttctttttatttaggactatgttttctataaataggggattaaaacctcattttttggggttagatacttttggtattattttattttgcgttggagattgttggttgcaaacttttagcaattaatcgatttatggattcttgttgaa

 

3195