LEFL1092CD12

LEFL1092CD12

 

1

 

ORF3

 

40F4420D2E645836

 

50

 

IPR000215

 

SEQUENCE: LEFL1092CD12_1_ORF3CRC64: 40F4420D2E645836LENGTH: 50 aa
InterPro
IPR000215
Family
Proteinase inhibitor I4, serpin
PS00284[37-47]? NA PS00284 SERPINSERPIN

 

chr02_finished_C02HBa0155E05.2.v1.seq_C02HBa0155E05.2

 

84.52

 

155

 

21

 

2

 

1090

 

1244

 

132355

 

132204

 

2E-21

 

103.0

 

AK247688

 

attctcattctcttcctctcctctctcactcggttgcctctccccctctctatactcctccagctggtgaagaccggcggaccagcaacaactttggtgaggctagcagccgttggccgcctcggcttcttcctctttctctcccttctccctccctcttcttatcttcctctccaggcgaggagcagtagcagccgataccatcggcatcttctgcagaaactaccaaacagaccgccggtagcagcaaatgcgaaggcgtaactctctctccaccttcctcttcttttttattctcctctctttgctggaccaccaccaccaccagtgcaacgagcaacccaacaacatcaacaacaacaactccngtgaaggaggaagttgcatgaggccagtgacgacaacagaaaacagcaatgtccccaaccaagcgaagctctgacaaaaactgccttctccaccagcagctccggccatggaacttcagtgagggccgagtttaaatatgaagatggcagatctcaacagatccgtccggatccgtcatttctcccgccatggagcgcttatccacttggttttttctgtgttcgggcctatatcgaatcaaattgggtcttcactgctgataaataataaggaaagatgtccaagtttgaaaatgcacaaggcatatagaaaaaagtgcagatttgcgacctacgaaggccatcgatggacagtaggtgttgacaattgatggtagttcaaggctaaaggagaagatcagggagatttgactaagtgtataaccacgagagtaaacgatgatccttatattgatcaacggaccgtactggtgaactatcaattggtttagtgaaggttctagtacctgactttttcaagattctatgtatggaacgacagaagagcatcgatggggtgtagatgaatcgacggaccgtattgctggtacgtcatttgatttagagaaggtgttggccagtgaagaaaaattattccaagtatggactgacgaggaaatcgatgaatcgtcgttccattgacagttctacagcgagatctttgtttgaattcgtgtttttggacaaaacttttcttattttatttctttttatttaggactatgttttctataaataggggattaaaacctcattttttggggttagatacttttggtattattttattttgcgttggagattgttggttgcaaacttttagcaattaatcgatttatggattcttgttgaa

 

3190