LEFL1088AC01

LEFL1088AC01

 

1

 

ORF1

 

87F98C215063E5B1

 

94

 

IPR004231 | IPR011052

 

SEQUENCE: LEFL1088AC01_1_ORF1CRC64: 87F98C215063E5B1LENGTH: 94 aa
InterPro
IPR004231
Family
Proteinase inhibitor I37, carboxypeptidase A
PFAMPF02977CarbpepA_inh
 3.2e-27 [50-87]T    
Parentno parent
Childrenno children
Found inno entries
ContainsIPR011052
GO termsBiological Process: defense response (GO:0006952)
Molecular Function: metalloendopeptidase inhibitor activity (GO:0008191)
InterPro
IPR011052
Domain
Proteinase and amylase inhibitor
SUPERFAMILYSSF57027Plant inhibitors of proteinases and amylases
 3.8e-21 [49-87]T    
Parentno parent
Childrenno children
Found inIPR000737IPR004231
Containsno entries
GO termsnone
noIPR
unintegrated
unintegrated
PRODOMPD012469FSPM_LYCES_P14903;
 0.003 [21-75]T    
SEGsegseg
 NA [6-16]?    
Parentno parent
Childrenno children
Found inno entries
Containsno entries
GO termsnone

 

chr08_finished_C08SLe0111P08.1.v1.seq_C08SLe0111P08.1

 

100.0

 

34

 

0

 

0

 

15

 

48

 

24918

 

24951

 

4E-11

 

67.9

 

AK247670

 

atccacattacttgtattattattattattattattattattattattaccatggcacaaaaatttactatccttttcaccattctccttgtggttattgctgctcaagatgtgatggcacaagatgcaactctgatgaaactttttcagcaatatgatccagtttgtcacaaaccttgctcaacacaagacgattgttctggtggtacgttctgtcaggcctgttggaggttcgcggggacatgtgggccctatgttgggcgtgccatggccataggcgtgtgattacaatttcgttgttcttctttttcgactttttaatcccaagtgaataaagtctaatttgaaaaagaagaaaaaaagtatctatgtctgagttatatgttttgtggctaataagaaatcgactatgcttgttgatttgataaaaattatgtcattagggtgtgatatgtaatcatcaaattaaataaaa

 

2915