LEFL1088AC01

LEFL1088AC01

 

1

 

ORF1

 

87F98C215063E5B1

 

94

 

IPR004231 | IPR011052

 

SEQUENCE: LEFL1088AC01_1_ORF1CRC64: 87F98C215063E5B1LENGTH: 94 aa
InterPro
IPR004231
Family
Proteinase inhibitor I37, carboxypeptidase A
PF02977[50-87]T 3.2e-27 PF02977 CarbpepA_inhCarbpepA_inh
InterPro
IPR011052
Domain
Proteinase and amylase inhibitor
SSF57027[49-87]T 3.8e-21 SSF57027 Plant inhibitors of proteinases and amylasesPlant inhibitors of proteinases and amylases
noIPR
unintegrated
unintegrated
PD012469[21-75]T 0.003 PD012469 FSPM_LYCES_P14903;FSPM_LYCES_P14903;
seg[6-16]? NA seg segseg

 

chr08_finished_C08SLe0111P08.1.v1.seq_C08SLe0111P08.1

 

100.0

 

34

 

0

 

0

 

16

 

49

 

10431

 

10464

 

4E-11

 

67.9

 

AK247670

 

atccacattacttgtattattattattattattattattattattattaccatggcacaaaaatttactatccttttcaccattctccttgtggttattgctgctcaagatgtgatggcacaagatgcaactctgatgaaactttttcagcaatatgatccagtttgtcacaaaccttgctcaacacaagacgattgttctggtggtacgttctgtcaggcctgttggaggttcgcggggacatgtgggccctatgttgggcgtgccatggccataggcgtgtgattacaatttcgttgttcttctttttcgactttttaatcccaagtgaataaagtctaatttgaaaaagaagaaaaaaagtatctatgtctgagttatatgttttgtggctaataagaaatcgactatgcttgttgatttgataaaaattatgtcattagggtgtgatatgtaatcatcaaattaaataaaa

 

2911