LEFL1095CH08

LEFL1095CH08

 

1

 

ORF1

 

29A8513E07D260F7

 

249

 

IPR000182

 

SEQUENCE: LEFL1095CH08_1_ORF1CRC64: 29A8513E07D260F7LENGTH: 249 aa
InterPro
IPR000182
Domain
GCN5-related N-acetyltransferase
PF00583[143-228]T 3.8e-05 PF00583 Acetyltransf_1Acetyltransf_1
noIPR
unintegrated
unintegrated
G3D.3.40.630.30[40-238]T 1.2e-20 G3D.3.40.630.30 no descriptionno description
PTHR10545[117-249]T 9.7e-49 PTHR10545 ACETYLTRANSFERASE-RELATEDACETYLTRANSFERASE-RELATED
PTHR10545:SF2[117-249]T 9.7e-49 PTHR10545:SF2 ACETYLTRANSFERASE-RELATEDACETYLTRANSFERASE-RELATED
seg[10-22]? NA seg seg[138-149]? NA seg segseg
SSF55729[40-238]T 7.2e-16 SSF55729 Acyl-CoA N-acyltransferases (Nat)Acyl-CoA N-acyltransferases (Nat)

 

chr08_finished_C08SLe0111P08.1.v1.seq_C08SLe0111P08.1

 

100.0

 

34

 

0

 

0

 

29

 

62

 

24713

 

24746

 

8E-11

 

67.9

 

AK247323

 

ttccaattttttttccttaatccatctattattattattattattattattattattattattatcaatatgtctacaattgataacaaccccctcacaattactgaaaaagtttatgttagagttagacttgcaaatgaaaatgatatacatcatatatacaaacttttttaccaaattcatgaatatcataattacactcatctatacaaagctactgaatcttccctttgtgaccttttattcaataaaacaaaccctagtcctctattttatggtccttcaatacttctacttgaagtatcgccaacgccttttttagatatcgatagtaaaaacgaaaaatttaagcccgtccttaaagaatttgacctaaggtcaaatgtcgtagacaaagaagccgatgaattcaagtccaattcgatgaatgataatgataagaacgacgtatatattgctggatattcatttttttacgcgaattattcgtgtttttatgataaggctggaatttatttcgaaagtctttattttagggaaagttataggaaattgggcatggggagattgttgtttgggacagttgcatcaattgctgcaaataatggattttcatcagttgagggaattgtggctgtttggaataaaaaatcatatgatttttatgttgatatgggggttgaaatatttgaagaatttaggtatgggaaaatggttggtgatgcattacaaaaatataaggacatttgatcatgaaaatatttttttaaagttattttgtacttttttttcttggtttttccattttgtaaaagcaatatttattactactatgtattgatttgtgtttggaa

 

1765