LEFL1007DD11

LEFL1007DD11

 

1

 

ORF1

 

1074C261D20CFDAD

 

225

 

IPR002160 | IPR011065

 

SEQUENCE: LEFL1007DD11_1_ORF1CRC64: 1074C261D20CFDADLENGTH: 225 aa
InterPro
IPR002160
Family
Proteinase inhibitor I3, Kunitz legume
PD000891[48-225]T 3e-91 PD000891 Q40129_LYCES_Q40129;Q40129_LYCES_Q40129;
PR00291[43-72]T 7.7e-15 PR00291 KUNITZINHBTR[84-104]T 7.7e-15 PR00291 KUNITZINHBTRKUNITZINHBTR
PF00197[43-223]T 1.6e-23 PF00197 Kunitz_legumeKunitz_legume
SM00452[43-225]T 7.1e-62 SM00452 no descriptionno description
PS00283[44-60]T 8e-5 PS00283 SOYBEAN_KUNITZSOYBEAN_KUNITZ
InterPro
IPR011065
Domain
Kunitz inhibitor ST1-like
SSF50386[39-225]T 3.5e-42 SSF50386 STI-likeSTI-like
noIPR
unintegrated
unintegrated
G3D.2.80.10.50[42-225]T 5.2e-41 G3D.2.80.10.50 no descriptionno description
seg[60-77]? NA seg segseg

 

chr08_finished_C08SLe0111P08.1.v1.seq_C08SLe0111P08.1

 

93.48

 

46

 

3

 

0

 

689

 

734

 

25012

 

25057

 

7E-11

 

67.9

 

AK246986

 

atgatgaagagccttgttctctttgtgtcaatagcactctgtgttcccttagctttgtcatcaacattttcttcagatcttctccttccttctgatgaagtagttcctaatggtaaaacatatgcttcagtagttgacagtgatggaaatccagtaaaagcaggtgcaaaatactttgtgttaccatctttaaggggtagtggaggtggtcttgttttgtctagagttgttgacaaaaatgttaaagtttgtccacaagacattgtccaagaacctcaggaacttaacactggacgtcctgtggagttctttccagcataccctaataaaactggtgaaattattaaagttaacaaccccataaatgttaacttcttttcacttagtaagacatcacgttgtgctaattttactgtatggaaaatggacaagaaatataaatatgtggtaggtagagggactctaggggcgctgaatcgcataaggaattggttcaggattgtgccatatggaaagggctataggtttgtatattgtccttcactctgtgttccttgcaaaattaggtgctttgacttattcatttcttatgaggaacgcgaaaatgttcaagttagacgcttggctgcctcggacaatgaattgccattttctgtttacttcaagaaggctgattaatcatcctccctattattaatattattattattattattattattattattgttgttgttgttgtaatattttctagctactagttgtgatacctatctatgtatatcatgactacgtggcaataataaagttaa

 

1336