FC04AB02

FC04AB02

 

1

 

ORF1

 

DA9F703EAD3192C5

 

87

 

IPR003422

 

SEQUENCE: FC04AB02_1_ORF1CRC64: DA9F703EAD3192C5LENGTH: 87 aa
InterPro
IPR003422
Family
Ubiquinol-cytochrome C reductase hinge protein
PIRSF000019[18-87]T 4.1e-44 PIRSF000019 Ubiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunitUbiquinol-cytochrome-c reductase (cytochrome c1) (complex III), nonhaem 11 kDa subunit
PTHR15336[21-87]T 9.5e-10 PTHR15336 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 7.8 KDA PROTEIN
PF02320[25-87]T 2.4e-44 PF02320 UCR_hingeUCR_hinge
noIPR
unintegrated
unintegrated
G3D.1.10.287.20[24-87]T 4.5e-25 G3D.1.10.287.20 no descriptionno description
PTHR15336:SF8[21-87]T 9.5e-10 PTHR15336:SF8 UBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 11 KD PROTEINUBIQUINOL-CYTOCHROME C REDUCTASE COMPLEX 11 KD PROTEIN
SSF81531[12-87]T 8.2e-25 SSF81531 Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)Nonheme 11 kDa protein of cytochrome bc1 complex (Ubiquinol-cytochrome c reductase)

 

chr09_finished_C09HBa0099P03.2.v1.seq_C09HBa0099P03.2

 

92.63

 

95

 

7

 

0

 

142

 

236

 

43334

 

43240

 

8E-31

 

133.0

 

AK224634

 

tagaacagtcaggtgattttgcagaatcgaagtcttcgtctcgaatatctctttgccatgtcggacgaggaagttgttgacccaaaggcgacattagaagtaagttgcaagcctaagtgtgtaaggcaactaaaggagtatcaggcatgtaccaaaaggatagaaggtgatgaatcagggcacaaacattgcactggacagtattttgattattggcactgcatcgacaaatgtgttgctgcgaagttgtttgaccatctcaagtaacaaggatataagttgttgatcccttgcaatttatcttctttttggttgttgaacaagtcattaccatattattcctcactgtgctgaagacttgtaaccctttcaatcaacttggttgctgcatggaaaattttgaactatgcacatcttaaaaagtgattaataaatcatactcgtgggttgaattggacccttttaaaaaaaaaa

 

13