AK127679

AK127679

 

Homo sapiens cDNA FLJ45777 fis, clone NETRP2004385, highly similar to Dual specificity protein phosphatase 1 (EC 3.1.3.48).

 

AK127679

 

AK127679.1

 

source 1..2448|/cell_type="neutrophils"|/clone="NETRP2004385"|/clone_lib="NETRP2"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/note="primary culture, neutrophils"|/organism="Homo sapiens"

 

NETRP2004385

 

NETRP2

 

pME18SFL3

 

-

 

-

 

-

 

-

 

aaaactttaaagcgtcatcacctgggcatattgttaaaaggcagcttctgtcttggcaagactgggcctgagcctgagattctgcatttctgacaggtccccagggatgctgatactgcgagtctgtggaacactcttcgagcagccctgagattatcagcctttaacccccggggggaggaagccgaaggcccagagaggtcaagtcacttgtccatggccacacagcgaacagccccagaccgaaagcagagggcacctgccacagacacacgacatctccccacccgaggcagcgggaatcagctgcctttccctggcccgggtgccgtgtttgtaaactcggctgcttggtgcggctcgggccggggtaaagggcgcctcccagcagagcctccctcgtctctgagctggcctctccaggttctccgtccggtatcccgggccgaccagagagagcccggggcgccgagtcctctgcggcggagcgattccgcactcccgtctcctctgaaagcaaacttctccgccggcgccctttacctttttcgggggtttgcagctgctcagcctgctgtgtctgcagcccatcctcctccgggggctcccggacgccgcttcccaactccggggcccccagaggagcctgcgatccgggccccgctgcccgctccgcgcccgccggctggggctgccggcgagaccctgaaactgaacctggaagcgctctgccgcgaggcgcgcgccgcgcaagtcttcttcctcaaaggtacgccctcggggaagctcggggcgggccgcacacccctgaggttttgcccggtacccctggctctcggctcccgggggatcgccccacctgcagcgcgtgggcgctggagtacatttatctctggaacttgtcattggctttgtttggctctggaaacaaagacttgcctgggcctttccgatgtaaacttccagcccttggtgggtgggggagttgtatgaaggtgccgtgtcccggtgtcactaatggggaaaaaaaatgtctttgtattcccaggaggatacgaagcgttttcggcttcctgcccggagctgtgcagcaaacagtcgacccccatggggctcagccttcccctgagtactagcgtccctgacagcgcggaatctgggtgcagttcctgcagtaccccactctacgatcagggtggcccggtggaaatcctgccctttctgtacctgggcagtgcgtatcacgcttcccgcaaggacatgctggatgccttgggcataactgccttgatcaacgtctcagccaattgtcccaaccattttgagggtcactaccagtacaagagcatccctgtggaggacaaccgcaaggcagacatcagctcctggttcaacgaggccattgacttcatagactccatcaagaatgctggaggaagggtgtttgtccactgccaggcaggcatttcccggtcagccaccatctgccttgcttaccttatgaggactaatcgagtcaagctggacgaggcctttgagtttgtgaagcagaggcgaagcatcatctctcccaacttcagcttcatgggccagctgctgcagtttgagtcccaggtgctggctccgcactgttcggcagaggctgggagccccgccatggctgtgctcgaccgaggcacctccaccaccaccgtgttcaacttccccgtctccatccctgtccactccacgaacagtgcgctgagctaccttcagagccccattacgacctctcccagctgctgaaaggccacgggaggtgaggctcttcacatcccattgggactccatgctccttgagaggagaaatgcaataactctgggaggggctcgagagggctggtccttatttatttaacttcacccgagttcctctgggtttctaagcagttatggtgatgacttagcgtcaagacatttgctgaactcagcacattcgggaccaatatatagtgggtacatcaagtccatctgacaaaatggggcagaagagaaaggactcagtgtgtgatccggtttctttttgctcgcccctgttttttgtagaatctcttcatgcttgacatacctaccagtattattcccgacgacacatatacatatgagaatataccttatttatttttgtgtaggtgtctgccttcacaaatgtcattgtctactcctagaagaaccaaatacctcaatttttgtttttgagtactgtactatcctgtaaatatatcttaagcaggtttgttttcagcactgatggaaaataccagtgttgggtttttttttagttgccaacagttgtatgtttgctgattatttatgacctgaaataatatatttcttcttctaagaagacattttgttacataaggatgacttttttatacaatggaataaattatggcatttctattg

 

-

 

16066