AK126570

AK126570

 

Homo sapiens cDNA FLJ44607 fis, clone BRACE2006986.

 

AK126570

 

AK126570.1

 

source 1..1667|/clone="BRACE2006986"|/clone_lib="BRACE2"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="cerebellum"

 

BRACE2006986

 

BRACE2

 

pME18SFL3

 

-

 

cerebellum

 

-

 

-

 

tttccagatgaagatgctgaggttctgaagaaaaggttaagtaacttgcttaaggttttcttcctccacatcccatgctccgacccaccaccccacccatactttatatccctattttatgttgctacctgttctttttaatgctgaccacatttccagaaatgcactaaactaccaaccttagcttacttaatccttctggccaaccttaggagaggtaggcattgttttatttatttattttttgtttgctttgttttattttagcatttcttttttttgtatgagacatggggcacatagtgaataagtgacagaagtgggatttgaacccaggatgtgtctgaatcagaagaccttggcatttactattatgttgtcttggaaccaaatcagttcatgctcaaaagctctcagtgtttcccaaggctctttgaatgaacttcagagtcctttatgcaccttacactccctacataatttgcctgtgcagaatcttgtagctttctcttccccaacctcccccttgtttgctctggtagccccacttgctctctattccttgaactgaccaagcactttttcttccttggcctgtcctcatgctgtgcttttctgtctggagtcaatcacctctttgcctcctcttcttccttttagtttaaggggtgttccctctgggaggccttcactgagccccagtctaggtgcgtccatgaccacattctctgtgaactgctgttgggtgatgtctgccttctgactatcctgtaagctccataaagtctgaaataccgttgactgctgtgttcccagtgcctggcacatggtaggcactcaacagatctttattgcccaatgcgtggatggaatgatcgtcttgaaattctagttcacctggaccccgactccaccctcctgttgctgtttttgttttcctctctactcccttcagctctcttcttacctctgctcctggaagtactcagccgctaaatccaaggttgaaaagaaaaagaaggagaaggttctcgcaactgttacaaaaccagttggtggtgacaagaacggcggtacccgggtggttaaacttcgcaaaatgcctagatattatcctactgaagatgtgcctcgaaagctgttgagccacggcaaaaaaacccttcagtcagcacgtgagaaaactgcgagccagcattacccccgggaccattctgatcatcctcactggacgccacaggggcaagagggtggttttcctgaagcagctggctagtggcttattacttgtgactggacctctggtcctcaatcgagttcctctacgaagaacacaccagaaatttgtcattgccacttcaaccaaaatcgatatcagcaatgtaaaaatcccaaaacatcttactgatgcttacttcaagaagaagaagctgcggaagcccagacaccaggaaggtgagatcttcgacacagaaaaagagaaatatgagattacggagcagcgcaagattgatcagaaagctgtggactcacaaattttaccaaaaatcaaagctattcctcagctccagggctacctgcgatctgtgtttgctctgacgaatggaatttatcctcacaaattggtgttctaaatgtcttaagaacctaattaaatagctgactac

 

-

 

16316