AK123514

AK123514

 

Homo sapiens cDNA FLJ41520 fis, clone BRTHA2012466, highly similar to Homo sapiens cell cycle checkpoint protein RAD17 mRNA.

 

AK123514

 

AK123514.1

 

source 1..1937|/clone="BRTHA2012466"|/clone_lib="BRTHA2"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="thalamus"

 

BRTHA2012466

 

BRTHA2

 

pME18SFL3

 

-

 

thalamus

 

-

 

-

 

tagctgcacttcctccttaggcggaggggaggattcagggaagcttggttaaaaacagttatggcagtgggagtcgaagcgagggtctgaagttcacgactactagaaggggaggggagtggaaaggctctcagtgaaaaaggtacagtaaataaatgtccagggatattgggggctgggaagttgaataaatggtctaatctaggctggaggccataagggggaaaacagttgattctcggaagctctgccttctccccctctctagtgcgaatcactgaggcgccatttgatttctcgtttcctgcatgttttggcagtttacagtgcaaataacggtaccttggatgtctgtagagttttgtgtgcatatacaaattctcttaactaggtttaatttcatttgctctttaccaccctactccccagagaataataagagccatcatgtgttaagttcttaatatgtgtctggacagcatttgcataacacgatatcatttgatcttaaaaaataaccttcttaggaaacaggcccagaaaggaaatgacttgctaaagttcacgcagctgataagtgagtggatagacattcagatctcaacctgtcttctttttacagatcaggacataggcaggaaaggttaggcctgtattacatagaatagtaactagcatttgcttactattgccttatagtttacatatttaataatatgttcacatgtatcatctcatcctcacaccagtcctgtaatacctttaccaggtggtgttgacttcatttacaatcagggaaactgagactaaaaggaattaagtgacttgcccaaggtcaagtcaccagttatgctggatcccaatctcaaactcctgacctcagatgatccgcccgcctcgtcctcccacggtgctgggattacaggcatgagccaccgcgtccggcccctggtctgcatcttttatttcgagctacaaactatatttactcaaataggtgttttttttccacctgtataccttttgaaacgtcacagtctctaatcgtgaacgatttggggcggagggctgaacaatgtgttttctagtgtgtcgaggtgtttataggctatgtgtgcctccaaactgtaaagtagtccagtatactttccaatgtataagtttgtagaccttaaacttttcttctggctaacttaaaatcgttgaattcactagtttgcataaacatttaagaatttgaaaacacggttgaaaaacagtgttaccaagaaattttgtaataacatgttcaaatgaagacaaaaattttacagtttaagacttaaattcttcgtccacagcaagtgaattcatggtattttacttttttgggaaatactggaaatgaagacctgcaactgtaatttgaaataaggaaaactttaattttcagtataaaaattgctcaaatagaattgcctgattttaatgacaaaagtatatgggagtccacatttatgtaagaaatgaaactataaaatgtataaataatttgcaaatcagaattgctgtcgaaatttttactataatgaaagatattttcatactctcaaaaatatagaggaaaggggccaagattatagtaccagtcacaatcttttgatgaggacgaaatgaatcaggtaacagactgggttgacccatcatttgatgattttctagagtgtagtggcgtctctactattactgccacatcattaggtgtgaataactcaagtcatagaagaaaaaatgggccttctacattagaaagcagcagatttccagcgagaaaaagaggaaatctatcttccttagaacagatttatggtttagaaaattcaaaagaatatctgtctgaaaatgaaccatgggtggataaatataaaccagaaactcagcatgaacttgctgtgcat

 

-

 

16435