AK123020

AK123020

 

Homo sapiens cDNA FLJ41024 fis, clone BRACE2001353.

 

AK123020

 

AK123020.1

 

source 1..1342|/clone="BRACE2001353"|/clone_lib="BRACE2"|/db_xref="H-InvDB:HIT000042893"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="cerebellum"

 

BRACE2001353

 

BRACE2

 

pME18SFL3

 

-

 

cerebellum

 

HIT000042893

 

-

 

gaagacgagggcggcgaggtcgggttccgggcgcttggagaagatggtgctgcggcggctgctggccgccctgctgcacagcccgcagctggtggaacgtctgtcagagtcgcggcctatccgacgtgcggcgcagctcacggccttcgcactgctgcaggcccagctgcggggccaggacgcggcccgccgcctgcaggacctcgcggctgggcccgtgggctccctgtgccgccgcgctgagcgatttagagacgccttcacccaggagctacgccgcggcctccgaggccgctcggggccaccaccaggtagccagaggggccctggcgcaaacatttaatcctgggctgtgcggggccgaggctgcttgcttttccttccgggctctacagtggcatcaatgtggaggggtcattccgggcactgcgcgcggcttcgaatcccgactgggattgttggcctgcagacatcccacgcataagagcctaggccagaccgcccgctccgttgaagtcttgtgattggacaagacacagtgtggagaaagacccctaagcctaacagagatgaaggtaggctgggtccagacacggcacctacggagagccacggaccgaagccagagagcctttcctctgcaagtgggactgaaactcttgacagatgctgctcaatctgactggtatagcaggacagttaattccagggacgatatggatgaaaagacaaccctacagctgccaaattcctttgattaaatgtgtgagctggttgataggcatgagtgtgatacttctcaggcaagatgtgttaagaataccggggactgtaggcctatggtaataataaacacgtattttatgaaatgagtcttctgtgctgggacttgctcattgcactctatgtgttatctcactccttacaacgacattcacatgaggaagcagattactttttggatttttttgtagagatggggtggtctcgaactcttgggcgcaagtgatcctcccgcctcagcctcccaaagtgctgggattataggcaagagccactgcgatggaaacagaggctgctgcttaagttgcccaaagtcttgcagagtgggatgtgagcagaggcatttgactccagggcctaagtccttaacacagctctgcagcatttaccctgatactcaaccccttccttccccaaccccccaccatcaggcattaagactactgcctaggggcagggcctggtggcagttgtgtcttatcccagccactgcagaggcaggaggatcgcatgagcctgagatgagaccagcctgggtagcatagcgagaacctttctc

 

-

 

17941