AK054569

AK054569

 

Homo sapiens cDNA FLJ30007 fis, clone 3NB692000012.

 

AK054569

 

AK054569.1

 

source 1..2003|/cell_line="NB69"|/cell_type="neuroblastoma"|/clone="3NB692000012"|/clone_lib="3NB692"|/db_xref="H-InvDB:HIT000011183"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"

 

3NB692000012

 

3NB692

 

pME18SFL3

 

-

 

-

 

HIT000011183

 

-

 

tttgaaaacttctcatgctattctaccaacttggaggcacctatccatgctcattcccctaatgtagccaatatggttatctgcaatgtattggcatctaaaaactcccttatgaaactgccagacttgttctggaacacttcaattacatgcaaaattcaggttctcaagttggaacaagtctaattgacacacctgcataggttttaatcttgccctccccctacttcccaacagatttccaagttttttgagaaggaaccttgctctggcccaggctggagtgcagtggcgccatctcggctcactgcaacctctgcctcctgggttcaagtgattctccagcctcctgagtagctgggattgcaggcacctgccaccacacccagcttttttgtatttttggtagagacggggtttcagtttgccaggctggtatcaaaccgtgacctcaggtgatccacccgcattagcctcccaaagtgctgggattacaggtgtaagctaccatacccagatttccacggctttttttttaagtctcactctgttaccctggccggagtgtggtggcacgatttcagctcactgcaagctccacctcccgggttcacgccattctcctgcctcggcctcctgagtggctgggactacaggtgcctggctaacttttttgtatttttggtggggacagggtttcactgtgttggccaggatggtctcgtgatctgcatgccttggcctcccaaagtgctgggattataggctcacgcctatattactatatagtggcctatattacaggccactccgcctggcctccaaatttccaagtttttaagtctccatgcaaacaggcataagcaagcactccttggctctacatttgcaggacaagctggaccaccattcagatgttggtagaaatgtaatccaagtggctattctctatgcatgtagctcctaggttcaagagcagtgtggtctgcggattttctacacaacctgccataaatgaaatttaagcctttggaaatttatagcattttcagctaatttgcattatttatctctgcaagatattgactagaaatcacgtttcagaacttctcagatgaaaacatcatacaacccttaaaactaagctcataatttaaaaatgtatgcagattaataggcttaaattgccaggactttagatagacattaccacttccaggttaatacttttagcggtttttatgccttcaatggtttgaagccctcaaccttagttgaaaacttaaaaatggcattgaatggctgctgcaataaggacacatgaattttggcttaagtggactaggaggactaaatcttgcttaggcttttaaaaaatgcccacccactgggtctagggattgaggttattttcctgaattatggctaattatggattacaattcaaggttaaagatacacatatagtattctcaggttattcatatgatagcattttttaagagccaaagtctcagtcacccaggctggagtgcagtggcttgataatggttcgctacagcctccaacttctatgttaaagtgatcctcctacctcagcctttcaaagtgttgggattataggcacgtacctatggccccaaagcactttaacaaatgagtaacagacacagttaaggtagaacctagcattttatttagatcttcattaaactgttggaattgagaaccagacatacgtaataaacctccaaaaatagatcctgaaaggcactttctgcttagggcaagcagtcatggaataagcatgtaaacaagctggcttctctgtaccacaccagccaagtcagctttctccatggccagccgcaccagctctgccctcccttctgttaacaccagccagaccccctgtaggtctaacccaaggtttttctgtaggacaccttggcctacctgggaatgctggaaacatgttgttaaaggaatcatggtgttgagag

 

-

 

4887