AK024187

AK024187

 

Homo sapiens cDNA FLJ14125 fis, clone MAMMA1002545.

 

AK024187

 

AK024187.1

 

source 1..1046|/clone="MAMMA1002545"|/clone_lib="MAMMA1"|/db_xref="H-InvDB:HIT000007461"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="Mammary gland"

 

MAMMA1002545

 

MAMMA1

 

pME18SFL3

 

-

 

Mammary gland

 

HIT000007461

 

-

 

atgcaaatattagaacgtgacaaataatggtcagcagaccaggtaagagacaggatttaattttctagctcaaattactggtttttaattataaccttgacatctgtaatcattaatattttgggaagcagtcccttttcatgcttatgttacttggatatatacttgttttaattaaaattgggggccaggcgtggtggctcctgactgtaatcccagcactttgggaggccaaggcaggtgatcacttgaggtcaagagttcgagaccagcctggccaacatagtgaaaccccgtctctgctgaaaatacaaaaattagccaggcatggtggcaggcacctgtaatcccggctacttgggaggctgaggcaggagaatcacttcaatgcagagggtagaggttacagtgagccgagatcttgccactgccctccagcctgggcaacagagcaagaccttgtctcagaaaaacaaaaacaaacaaaagctgtatatatttgcaaaaacactatagtagacataccagaccatcagctccctagggctttttatgaaaaacagcagtccttccccactccccttcccagccccttagaagcagtcattttcaactctccagttccttttggtatatctctctaaataataagcctcttttgctttacagtgtttgttattatttattaacttcactccttaaatagtggtcgtttttggtaggcttacctgaccacctcacatgccaacattaattgtcactctggggccaggcacctggctcacgcctgtaatctcagcactttgggaggccgaggcgggcggatcacaaggtcaggagatcgagaccatcctggctaacacggtggaaccccatctctactaaaaatacaaaaaattggccgggcgtggtggtgggcgcctgtagtcccagctactctggaggctgaggcaggagaatggtgtgaacccaggaggcggagcttgcggtgggctgagatcgcaccactgcactctagcctgggctacagagcgagactgcgtctc

 

-

 

2274