AK024186

AK024186

 

Homo sapiens cDNA FLJ14124 fis, clone MAMMA1002498.

 

AK024186

 

AK024186.1

 

source 1..2488|/clone="MAMMA1002498"|/clone_lib="MAMMA1"|/db_xref="H-InvDB:HIT000007460"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="Mammary gland"|CDS 697..1197|/codon_start=1|/protein_id="BAB14847.1"|/translation="MALHSGWRNCDSCAGRWWGFSQLHGQCQAWEGSVSPTFSSRPSY|PRVVFLTWAVSLTSCVPPCPSPEPKVVFAKEQPAHREVQAEAGASATLSCEVAQAQTE|VTWYKDGKKLSSSSKVRVEAVGCTRRLVVQQAGQAEAGEYSCEAGGQQLSFRLQVAGQ|CFGDAE"

 

MAMMA1002498

 

MAMMA1

 

pME18SFL3

 

-

 

Mammary gland

 

HIT000007460

 

BAB14847.1

 

ttctttgattgtttaaccttacaaaaatttagactagtaacttatttcacactgaaaagtgagttccaggaaggttagaggccacagagtataaaaggtaaaaccataaagcctctagatgctaacatagattgctaaaaacttcagggaacggaaagatttcttaaaactaaacagtggaacaatggtatatttaactacattaaaactaaaactttaatttgtcaagacatcatttgagagcgaaaaggccggtcaaggacatgggtaagatgtttacaaatacacagttatcatttgctagcatttaaaatatataaagagttcctaaaaataaggaaggaaaagacagaaaaggctactgaaaattggacagaagcctgaagagcgacaccccagaagagctgacgtaatggccagaagtggtggaaagggctccaccttgcatgtcaccaggcaatgcatgacaaagcccaggccttccccgcagaggccaacgctgaccctcctgacagtggcaggactggaagcctcagtactctggggccctgcagtgaggacacgccctgcccagtcccatggggagaccctagcatatccttgaagggagctgtgtaagcattaggaacccagtccctgcactggaggagctcgtgcacggagggtttgtcacaactgccccgcctggaatagcccatggcactgcacagtggatggagaaactgtgattcttgtgctgggaggtggtggggcttctcccagctacatggccagtgccaagcttgggaaggttctgtttctcctactttctcgtctaggccctcctaccctagggtggtcttcctgacctgggcagtatctttgacctcgtgtgtccctccttgtccatccccagagcccaaggtggtgtttgccaaggagcagccagcacacagggaggtgcaggctgaggcgggggccagtgccacgctgagctgcgaggtggcccaggcccagacagaggtgacgtggtacaaggatgggaagaagctgagttccagctcgaaagtgcgcgtggaggccgtgggctgcacacggaggctggtggtgcagcaggcgggccaggcagaggccggggagtacagctgcgaggcagggggtcagcagctctccttccgcctgcaggtggcaggtcagtgctttggggatgctgagtgagccctgtttgtagctgctgctgtgactggagtagaaccactgctgacccagtgggctttccattagactccatccctcaacttctcccatcctctcacctcctatttttatgcctgtggtggagctgggctgcttagtggggaagggagtgaacggaagggtcagggccctccttgtccatgttgggtggtgtttctgtgcagacatgctgggtcacattttcccagtaccttctccaaactaccgatgtcccgaggtgtccaggactctggtcctatctaatgcatgagatggcggtaagccagacgtccctccctcggggatactcctgcagtccctgcacggcctcatctggccccatgtgagggctctccctgtggaaagagattttaattcgttgagtcagggtgtagggaaattccagccacacagtcttatttggaattatatcaacactgaacactgggttcccaaagttttcagtgttctgggacacacttctgtccttccctgtggatgtagaagccctgtcagagccctgactaaaacccagatccacagcgttagtgtgtgcaaaacgagtaaagagcagcacattggcaggtgcgcacacgtgacgttggaattccatttcggaagccaatctcactttccttttgcattctgttagaatgttctgtgtctgaattccccttggaatttggatagatttaaaagtgataggaataagtagctggtgtttctagcctccgcctccaggcgggtgaggaggtgacacctgagaattcctccctctcacccctgaccctgccggaaagcgaaactgagatgcgggcattgggccctgggaagcgtggggaaggggaaaggagaaagccaggtgggtttttaggtcccttccagtgccacactgtggggtgttgaggggccgcgcgaggcaggcccttccatgaggcctggactggaggccttctctaggcgccggcgctggcctgggccgcctgccgccacacaggggccgcacgcctgggccccagggcccctttgccggcgggaggccggggggaccgactgctcttggcgcccggggtcaggggaggccgggaaacctcggctcccgggcgacaggcacccaggcccttctcagccccccggccgcggccgcgccgggcctcgcttcagccgggcgattcttcccctcatttgttgcattgtttgcattaatatgaatatcttgttctgtttgttttgtctcctgagagccaataaagctgtgttttttctttacacc

 

MALHSGWRNCDSCAGRWWGFSQLHGQCQAWEGSVSPTFSSRPSYPRVVFLTWAVSLTSCVPPCPSPEPKVVFAKEQPAHREVQAEAGASATLSCEVAQAQTEVTWYKDGKKLSSSSKVRVEAVGCTRRLVVQQAGQAEAGEYSCEAGGQQLSFRLQVAGQCFGDAE

 

2273