AK024185

AK024185

 

Homo sapiens cDNA FLJ14123 fis, clone MAMMA1002155.

 

AK024185

 

AK024185.1

 

source 1..1974|/clone="MAMMA1002155"|/clone_lib="MAMMA1"|/db_xref="H-InvDB:HIT000007459"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="Mammary gland"

 

MAMMA1002155

 

MAMMA1

 

pME18SFL3

 

-

 

Mammary gland

 

HIT000007459

 

-

 

aaagtgaatagaattgttttcttactcaaaacactgtttaacatgacacttggctcctttctttgcatctctgagctcttgtaagatttgagaaacaattacattcaagggcagtatgcttaacctactgacatttgaactacaaagcaaagatgttcagattttcctgaaggatcaagtctttcaggccacagaattttctgtcctagttttttaatacagtagtccccccatatctgcaattttcctttccacattcaattacgcatggtcagctgtagtctaaaaatattaaatggaaaattccagaaataaacaattcataagttttaaattacacactattctgagtagcatccatgatgtgaattcttgctttgtgcggcatattcatgcttaaattctccccacccattagtcacttagtagccatctcagttgtcacggactgtcactgtatctcagtgcttgttttcaagtaacctttatcttactaatggccccaaagcacaagtgtaatgatgctagcaattcagatatgccagagaagctgtaaagtgctttcttaaagcgaaaaggtaaaagttattaatttaagcaagggaataaaaatcatatgctaaggttgctaagatcgagggtgagaatgactcttcctgctgtacaagatgatcatccccagagcacatagccgtcagactttccaaggtcaatacaaaagaaagaatcttaaagacagctagagaaagggtcatataactcatcatgctaacagcagacttctcagcagaaactttacaagtcagaagagattgggggactgtttttagcattcttaaagaaaagaaaagaaatcctggctgggcacggcggctcacacctgtaatcccagcactttgggaggccaaggtaggcagattgcttgaactcaggagtttgagaccagtctgggcaacatgatgaaaccctgttcctacaaaaaatacaacaattagctagctgggtgtggtggtgtgcgcctgtagtcccagccactccggaggctgaggcaagagaatcgctttagtctgggaggcagaggttgcagtgatctgacatctcaccacggtattccaccttgggcaacagaacaagaccctgtttaaaacaaaaacaaacaaaaaaacaggccaggcgcggtggctcacacctgtaatcctagcactttgggaggctgaggtgagtggatcacctgaggtcaggagttcgagaccagcctggccaacatggtgaaaccccatctccactaaaaatacaaaaattagccgggcgtggtggcaggtgcctataatctcagctactcaggaggctgaggcaggagtattgctggaacccaggaggcagaggtttcagtgagccgagattgcaccattgcactccagcctgggcaacaacagcaagactctgtctcaaaacaaaaaaacaaaaaccaaaaaaccatagtgagacccagtctctttaagaaaaaaaataaaaaagaaaaatcctaaccaagaattccatatcctgccaaactaagctacatgagcaaagaagaaataaaatctttcccagacaagcaactgctaaaagaatttgttatcaccagactggccctacaagagagtcttgagagttctaaacatggaaatgaaagaatggtgacacctgctaccacaaaaatacacataagcacatagcccacagaccctgtaaagcaactacacaatccaaactacagagcaaccagctaatgacaccatgttaggaataaagcctcatgtctcaatattaaccttgaatgtaaacaacctaaacaccccacctaaaagacttggagtggcaaattggattaaaaacaagacccagccttctgctgtcttcaagagacctctctcacatgtaacaggactcataggttcaaagtaaagggatagggaaaaaaatctatcacac

 

-

 

2272