AK022232

AK022232

 

Homo sapiens cDNA FLJ12170 fis, clone MAMMA1000664.

 

AK022232

 

AK022232.1

 

source 1..2475|/clone="MAMMA1000664"|/clone_lib="MAMMA1"|/db_xref="H-InvDB:HIT000005506"|/db_xref="taxon:9606"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="Mammary gland"

 

MAMMA1000664

 

MAMMA1

 

pME18SFL3

 

-

 

Mammary gland

 

HIT000005506

 

-

 

tgttccatgctctctaggtgtgcctctttcaatatttcctgtccttttcgccactgctcataaatggtttctaatcattcttataattgtaccttcttggagccttgagagacaggcacaggttctcttacataggctattattgatattggttgcttttattttccctccaacccccactccagataacaactgttgagtgcgtaccatgtggcaaacaatgggaatgaagagattaatgagccctcaaagaattcatgatttacgtagcacatacttctagctaactgttctagctacaccagccagttctagagaggtacccatggaggttttggatatgtgcttaactccttgaagattcttctggaatgatgcctaaagtaattgtcaagagaagctatgctaatcttcctcttcagaatattcccatttctttcttagttataggtatgaggagtctaaaatatgctttaacatagtaagcttattgttataactggaaccatgcaaaatcttaatttcctataatataatttcttgctcctccaaagtcattcaaatattaaattggacttattctatatgttgcttagtggaaaggtatcacaaataaaaagtgggccacaatgagtaggtcaattaaataaatgcaaaaaatatattgatttattaattacaatataatactgtgctaaatgcttagcttgcattatctcatttaattcttaccaaaactctttgaggtgattattgtatacactcccatttacagatgaaaaactgaggtttaaggaaaagatgtgtatgcccaaatttcttaatgactaaatggcagcagaccaggactgtcttgactccaaagaacatgttctaatactgtacagcttcagactccttcatgagagctgtgatgctcaataatatatgtcaggatatgaatacttagactcatgccagaccatgtcataagccttagacctttttcatttgtgtttatagatagtgaccttttagtgcagtgacaatttcttaccacacagcaatctgcatgcaaggaattgctaatatctgctttgctcagaaggaagcttgtatgtagcattaattatggcaccattaatccattcagttatttattgaaactattatttgttgagtttctgctacatgcttggaagtttcatgtgttatctcctttaaactcactgtaaaaggcatgaggataccaattttctatatctgcagtaattttcccagggttacgtagctcctaactggatgtagtgtcttggattcagacccagctgtttgtctccgaagtctataccaaactaccctggtagtttagagcttatgtttaccagaaatttatgtcccaccagcacgtaatttttaaaccaactctgttgaggtataatttaaataaatgaaatgcacatgttttaagtgtgatacatttggtaagatttgattatgtatatacccttgtagctaccacccccactcaaattatacatttccatcactcagtaaattgctttgtgcccttttgcagtctctcttactccttgccccaggctaccattgatctgatttccatcactgtagactagtttttccaattctagaagttcatataaaaggaatagtacagtatatactcttttttgcctgattttttcacttaatgtaaagttttgtgagattcatacatgttgttgcctattcaatagttcattcttttttattaccaaataatattccattatatcacacatcacatttgtttttccatttgtctcctgatgtgtatatggttgtttctagtatggggtgatgttgaataaagctgctatgagcgttcgtatcccagttttattggctcatccactgttgtccaaaagaatttcttgaactctgcatttgtcctgaaggattctctgattgttcttcatacaagaactctaggaatataacatggaatccagctaatttctgaaactcatgtatttaattatacatttacactaacggccgtgtgcactgagaaaaatcctcctgattaatggcattgcttttagagtcagtgatcttttatttctcatgcaagtcatagtcaccactgtcagtcaggcttctcagttccaagcaactgaaaccaatcctggctcccttaaaaagtagatgaatctggccaggcatagtggctcacgcctgtaatcccagcattttgggaggtcaagccgggcagatcacgaggtcaagagattgagaccagcctgaccaacatggtgaaactctgtctttactaaaaatacaaaaattagttgggtgtggtagtgcgcgcttgtagtcccggctacttgggagactgaggcaggagaatcgcttgaacccgggaagcgtaggttgcagtgagccaagatcgcaccactgcacttcagcctgggtgacagagtgagactccatctc

 

-

 

2821