AK000905

AK000905

 

Homo sapiens cDNA FLJ10043 fis, clone HEMBA1001085.

 

AK000905

 

AK000905.1

 

source 1..1507|/clone="HEMBA1001085"|/clone_lib="HEMBA1"|/db_xref="H-InvDB:HIT000003379"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"|CDS 101..574|/codon_start=1|/protein_id="BAA91418.1"|/translation="MSCSNVETTGAPWRPTLRPWVWTRRPRTRPFCTGTGPPATSSWK|ITTKQKQRHPKVGEWWALVWSCRASVVGKDSGTAAPSHSPPLAPETHLPSFFPTASGL|SFSAATLTFSEAEAPSPTFVPPTFFWPFLEIFPYCSCLETVASWVLTALLFVLSH"

 

HEMBA1001085

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

HIT000003379

 

BAA91418.1

 

gacaccctctccgcgatgactgtgagtggtccagggacccccgagccccggccggccacccccggggccagctcagtggagcagctgcggaaggagggcaatgagctgttcaaatgtggagactacgggggcgccctggcggcctacactcaggccctgggtctggacgcgacgccccaggaccaggccgttctgcaccggaaccgggccgcctgccacctcaagctggaagattacgacaaagcagaaacagaggcatccaaaggtaggggaatggtgggccctggtgtggagctgtagggcttctgtggtgggcaaggactctgggaccgctgcaccgtcacattctcctcctttggccccagagacacatctgccttctttctttcccactgcctcgggcctttccttttctgcagctaccctcaccttttctgaggctgaagcaccgagccccacattcgtcccccccaccttcttctggcctttcctcgagatctttccctactgctcttgcctggagacagtggcctcatgggtgctgacagcgctcctgtttgtgctcagccattgaaaaggatggtggggatgtcaaagcactctaccggcggagccaagccctagagaagctgggccgcctggaccaggctgtccttgacctgcagagatgtgtgagcttggagcccaagaacaaagttttccaggaggccttgcggaacatcgggggccagattcaggagaaggtgcgatacatgtcctcgacggatgccaaagtggaacagatgtttcagatactgttggacccagaagagaagggcactgagaaaaagcaaaaggcttctcagaacctggtggtgctggccagggaggatgctggagcggagaagatcttccggagtaatggggttcagctcttgcaacgtttactggacatgggagagactgacctcatgctggcggctctgcgtacgctggttggcatttgctctgagcatcagtcacgggtaggtggagtggagaggctggttacagcttcagtccctttgtctgtctgtccatccattcctccatccacccatctgtccatccgcccatctgcccgtccatccatccatccactcttccaccctctaccccttaccttattctaaaaagaacttaggtaggttatggtgcctcacacctgtaatcccagcactttggggggctgaggcaggtggatcacttgaggtcaggagttcaagaccagcctggccaacaaggcgaaaccctgtctctactaaaaataaaaaaattagccgggcatggtagtgcacgcctgtaatcccagctactcaggaggctgaggcacgagacttgcttgaacccaggaggtggaggttgtggtgagctgagatcgcgccactgcactccagcctgggtgacagagcgagactatctcagaaacaaaacaaaacaaaacaacaaaaaaagaaaaggcagagtacaaggagatacatgtaacaag

 

MSCSNVETTGAPWRPTLRPWVWTRRPRTRPFCTGTGPPATSSWKITTKQKQRHPKVGEWWALVWSCRASVVGKDSGTAAPSHSPPLAPETHLPSFFPTASGLSFSAATLTFSEAEAPSPTFVPPTFFWPFLEIFPYCSCLETVASWVLTALLFVLSH

 

42