AK000901

AK000901

 

Homo sapiens cDNA FLJ10039 fis, clone HEMBA1000975.

 

AK000901

 

AK000901.1

 

source 1..2590|/clone="HEMBA1000975"|/clone_lib="HEMBA1"|/db_xref="H-InvDB:HIT000003375"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"

 

HEMBA1000975

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

HIT000003375

 

-

 

cacttgggctcgcgtcctcggccgcgccgcgcggcacccgggcccagcagccgggaggcggcagctctcctctacgcccgtcccctcagggcggctgtggatgttgccagtattgtcgatgcttcagagcgacgtttgccctgcgacacaggcgggccggctctcctctgtctttattttcctggaggccgacaggagcggggcccgagttcggtggtggtcgtgagcgtggggggcactcaggcccggacgggctctcaggtcgccgacggcggcggctggaggccgcgctggctgtcccaggtcgtcgttagctttagggagccgatctccgggcggccccacagaggacgcccgcgattcgatggcgatgatgcccgttttaaatggtgtccctgcagccgggtggatggatggatcgtacaccttgccttttgagagccgggaccttacgcccgactgcgtgttatttctgcggaataagaacgcaacctttggaggtgaagacgactgtcggctggattgaattggaatcgtgtttgtgatgatgcgtttatttctggaaatacgcggtctccgctgcttttgctttttgtcggcagaggtttgggttcttctctaacggtcaggataaaggcctgtaggcgacgctgcgcgagcgagaagctcgcccgcggctgcccgggcgcccccctctaggtgtgggtggagccgagcgcgcggggagaaccgccggccccgactcagccaccggtgactgcgggcgacccgcgggcctgcggccagctgatttcaaacatcgttttcctctttaggttcggaaaactgaggcgctggacaaggctggaatacaatatgtgattatacgtacagtactatggttgttgtagtttttaaattgtaaaacaagaagtaaccattgttccaccgttctctattaagtttgtgtaaattaaaaaggggctattttcggtaaaaagtgcagtaggtgtggtggtgtcgacctgtcatcccagctacttgagaggctgaagggggaggatcgcttgagcccaggaggtagaggctgcagtgagtcatgatggcaccactgcactccagcctgggtgacagagtgagagcctgtctcaacaaccagaaaaaaagtatttagttttacagtattacaaagtagtgtcacattagtttaatgaggtttatttatacaaaggtgtaaaattatgggccaagtactagccttcaagtaatttcgaagtcagcgagaatactggtatataacggatcaaactttgttcaagaaccaaaggctattgttcaacgaatggtgctgagacaactgcaaaagactaggacccttacctcacatgcaaaagactgggacccttacctcacaccattttgcaaaaattagctcaaaatggatcaatgacctaaatgtaagggaaaaactataaaattctcagaaaaaaacagaaggataaatttgtataaccttggatttgacaggattcttagctatgacaacaaaaacacaagcctccagaagcaagcaaacaaaaacaccataaactggacttcatcaaaattgaaaactttagtggttcaaaagacaccatcaagaaagtgaaaaaatccacagaataggaaagatatttgcaaatcatgtatctgataagggatctatgtctataatatgtaacgaactcttaataaaaaatagccccacttaaaatgggcaatgaatctaaatagacatttctccaaagaagaaatgcaaatggccaataagtacatgaaaagatgcttgacatcaccagagaaaagcaaataaagaaactgcaaggttttcattcttcttcacttacaaggcttcattctcactatgatagccagaataaaaaagtcagataacaacaattattggcaaagatatagaggaaaactgcaaaccttatacattctgataggagtgtaaaatggtgcagccactttggaaaacagtctggcagttcctcaagtgattaaacatctagttactatatgacccagcaattctactactaggtatatacccaagagaaatgaaaccatatgtccacacagaaacttgtacacatttgtttacagaagcattattcagaatcaccaaaaggtggaaacaacccaaatgtccatcaactgacacatgcaaaagtaaaatatggtatccatataatggtatattatggtatataaaagaatgaagtactgatacatgctgcaacatgaatggatcctgaaatcattatgttaagtgaaggaagctagtcacaaaagaccatatgttatatgattgcattcaaatgaatggaatatggaaatctatgcagacagaaagtagattactggctgtttaaagctgagggtgggagcatgggtgggcaggggaatagctaaagggtacagagtttctttccgaggtaatgaaaatgctctaaaattgactgtagtgatgattgcacatatctgtgaatatactaaaaaccactgaattgtacactttaaatgggtgaattgtatggtatgtgaattctatttcaatgaaactgtt

 

-

 

38