AK000900

AK000900

 

Homo sapiens cDNA FLJ10038 fis, clone HEMBA1000971.

 

AK000900

 

AK000900.1

 

source 1..1461|/clone="HEMBA1000971"|/clone_lib="HEMBA1"|/db_xref="H-InvDB:HIT000003374"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"|CDS 167..577|/codon_start=1|/protein_id="BAA91415.1"|/translation="MPRPPRGYPACRSRAAAPGWRWGRAEAAEVLRATGGWQWAGERG|RQARLGLGLWRRGTLCLGSLTAPPGSPERGTGGEGGGSWAPCAAGPRGARVAAGPAGP|DRVNGRAWPVPRGAPAATALAAGTGVLRGRSLPF"

 

HEMBA1000971

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

HIT000003374

 

BAA91415.1

 

tttaaggcgccgggtttccggggctcctggccccgcttattccgcgggggtcggcggggtcggcctgggcgcccgcgccgccgctgcgctttgtccgctgggcacactgcttctgggaggggcgggcagacatggtggcggccgccgccccctcctcggccctagcatgccgcggccgcctcgcggctacccggcttgccggtcccgagcggcagccccggggtggcgatggggtcgcgccgaggcagcggaggttctgcgggcgactggaggttggcagtgggcgggagaaagaggaaggcaggcgcggctgggcctcggcctctggcgccgcggtaccctttgtctcggcagcctgacggccccgccgggctctccggagaggggaacgggcggcgagggtggcgggtcctgggcgccctgtgctgcggggccgagaggcgctcgggtcgcggcgggaccggccggaccagacagggttaatggaagagcctggccagtcccgcgcggggcccccgcagcgacagccttggccgcggggactggagtcctgagggggagaagcctgccgttctgaaggctcgggacttctgccccaaagacttcgccgccgagaactgcgggtgcactgcctcagggaagaagttgagaattttgccaggtcatctctgccagggcacagttcatcactgtgtgtttagtgtgtttcggtgaagctctccaagtgtgttgaatcagcgtgcctagcctcaagggtgcatcgtgaaaactgaaaccaaaggaatgatacaggcctgctttgtgtgtgtcttcccactttaagcttgttttcagtacaaatactcttgctttaaacctgattggactgtggcgagcggacatctgttcaaaggaggggccgagaccacagtacttctgaagggggcttgataatgtggaaacattttaagttttctctccggactgttttgctctctcaattcaggcaagttactgaagtacgttttttatctagaaaaaggtttgatgtagtctgtaaatggtccttgtaaagtacattgccatctcagaattaaaagatccactctcatttattatgcagaagttagtggtcattctttcctgtagatagtttatctcatgtaaagacccacccagcttggtttaaatttttttctcactgacgtataaccatcagctttgatacttccattttcaggctcagactttgaatttaaggaaactaaagatgactttattttcttttctcttggtttttttttccaaaaacaaaaaataaatccattacatgttaacatagatgataagagtgacatcttgcatttttgcaaatctttttaatgcctggtttaatagaagattctcagatctacgtcagactgttgtggttagcacaccatgtaacctctggaacactccactgtacactcatactttttt

 

MPRPPRGYPACRSRAAAPGWRWGRAEAAEVLRATGGWQWAGERGRQARLGLGLWRRGTLCLGSLTAPPGSPERGTGGEGGGSWAPCAAGPRGARVAAGPAGPDRVNGRAWPVPRGAPAATALAAGTGVLRGRSLPF

 

37