AK000890

AK000890

 

Homo sapiens cDNA FLJ10028 fis, clone HEMBA1000752.

 

AK000890

 

AK000890.1

 

source 1..1731|/clone="HEMBA1000752"|/clone_lib="HEMBA1"|/db_xref="H-InvDB:HIT000003365"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"

 

HEMBA1000752

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

HIT000003365

 

-

 

aataagtagcctccaggcattcccttccaccagaggagcaattgttttttaaatagccctttggcgcccagtctattactaaaccatatgagtcattttttaatattactgcatgtgagttaacatagtcttcccaaattaaagttttagatgggccctcaaaatttttagggcatggttttcctgcaggtttatatggaaagtatggggtccctgacttctcgcaacagtggcctacactgcctttcagttctgtacctaggcctccaaagcactttagcctgtggggcttgccagaactcgggttccagctcctggaatggacagttcccctctggctagggttgatctaatgttccctctgggttactggctgagttctgccctgtgtggctttctgctgtgccagggctgcactgagttcaaatgcagagtctcacaatcattgtattcttcctcccccaggagcacccattctctctttacaccaattggccactgccaggggatgaagagggatgatgttgacaattcaagactatttcttaccctcttcagtgcctgtttccttaatatgataataaaccaggtactgcgatcactcacctgattattggttcttatgaaggtgcttttttaatgtagttgttcagtttgatatttctgtcggagggatgactgctggaggattctattaagccatcttgctctgccttcttgcaacacataaaattcaacagttttgtgcaactgtaagttcaagtgtttgtaattttatttatttcatttttttctttgagatgaagtctccctcttgttacccaggctggagtgcagtggcgcgatcttggctcactgcaacctctacctcctgggttcaagcaatcctcctgccttatcctcccaagtagctgggattacagatgcctgccaccatgtcttgctaacttttgtacatttggtagacatgaggttttgccatgttgtccgggctggtcttgaactcctgacttcaagtgatccacctgtcttagcctcccaaagtactgggattacaggtgagagtcactgctccctgctgcaaatttcttattaaatctgtttgacagattttagaatttctataagtaatgtttaaaattacaaccatttgggctgggtgtggtggctcatgcctgtaatcccagcacttattttatttcttatcaggagaacgagaatcatcatactactttgcatcggaggttaagctcattcttttccttaaaatgggaagataaaggcattaccccctctccgaggcctcatatgatactccccattctgacccagaacacccagaactttggaaattggctattgccatgtctggactgcaagtatgggaagcagaaactattctgtctgttgtccccactaccatctccctctctcagtatcaacgtagatccagacattctgctttacctacctccaacctgtttccatacagagttctgttaagcctccttgcatgctgttagtgagatatatcaaaatttggatgaacaatcaaactgtccaatgcattaattgtcatttatacacttgtattaactcccattttgattccaggaaaagtgtaatgttggttcgagctcaagaaggaatctggattccggtaactttgcccagaccttgggaatcctccccttcaatacatttaattaatgaagtgttacagtgaattct

 

-

 

28