AK000886

AK000886

 

Homo sapiens cDNA FLJ10024 fis, clone HEMBA1000636.

 

AK000886

 

AK000886.1

 

source 1..1672|/clone="HEMBA1000636"|/clone_lib="HEMBA1"|/db_xref="taxon:9606"|/dev_stage="embryo, 10 weeks"|/mol_type="mRNA"|/note="cloning vector: pME18SFL3"|/organism="Homo sapiens"|/tissue_type="whole embryo, mainly head"|CDS 31..477|/codon_start=1|/protein_id="BAA91406.1"|/translation="MVFLTAQLWLRNRVTDRYFRIQEVLKHARHFWGRKNRCYRLAVR|TVIRAFVKCTKARYLKKKNMRTVSVDPGHPPASALAAPAFLRRDPASVQPPGHPQPLP|FIPCFETPTNYVAPQANCGTSVLPPRRHPHCHPLLQPLARATAEPP"

 

HEMBA1000636

 

HEMBA1

 

pME18SFL3

 

embryo, 10 weeks

 

whole embryo, mainly head

 

-

 

BAA91406.1

 

gagtgttcgggacgcgggcctgcaggcgccatggtcttcctcaccgcgcagctctggctgcggaatcgcgtcaccgaccgctactttcggatccaggaggtgctgaagcacgccaggcacttctggggaaggaaaaatcgctgctacaggttggcggtcagaaccgtgattcgagcctttgtgaaatgcaccaaagcccgatacctgaagaaaaagaacatgaggaccgtaagcgtggacccgggacacccgccggccagcgcactcgcggcccctgcgtttctgcgccgcgacccagctagtgtgcagccgcccggccaccctcagccccttcctttcataccttgcttcgaaactccgacaaattatgtcgccccgcaggcaaactgtgggacatccgttctcccgccccgccgccacccccactgtcaccccctgctccagcccctcgcccgggccactgcagagccgccttgacactctccctgcgtcgccagccaccgccctagtcgctgctgctctcatccctccggtggcttcccttccctttggcagctgaagtcaacccagccccttgccaaccctccagggctactatctgctgccgtggtgctcctcgaagagaccacgcctgctgccaagctctgcccacccggaaccccccgcatttctgggaggctggcgcctccactctgtccacgtgccgcctcattactgcgcctcaccactcccgtctcagcctcatgaacctagcatctaacgtaccccggtttttttttcttaccccgagacggagtctcgcgctgtcacccaggctggagtgcaatggcgcgatctaggcttaatgcaacctcgtctcccgggttcaagcgattttcccgccccagtctcccgagtaactgtgactgcaggtgtgcgccaccaagctattttttgtatttttagtagagaccgggttccgccatgttggtcaggctggtctcgaactccagatctgaaatgatctgcctgccttgccctcccaaagtgctgggattacaggcgtgagacaccgtgcccagctgggtttttgctgtttttaattttgaaacagggtcttgatttcgcttaggccagagtgatggcaccatcatagctcactgattttgctatttacttttagaaaaatattctttagatcaattagaggctttgctgggacataacatccagaagtcatttttaagtatcttcatgttttcttatttcagctctggattaatcgaattacagctgctagccaggaacatggactgaagtatccagcgctcattgggaatttagttaagtgccaggtggagctcaacaggaaagtcctagcggatctggccatctacgagccaaagactttcaaatctttggctgccttggccagtaggaggcgacacgaaggatttgctgctgccttgggggatgggaaggaacctgaaggcattttttccagagtggtgcagtaccactgaggactgttgctgtattgattaggaaaagagacagagtaatttgcagtttgtttgatttatacttttgtttatctacaacccaataacagacatgagggatggccctgtctctctgggacagagcctcaaagatgatgtccatgttttgtgtgaatgaaactcaaacactc

 

MVFLTAQLWLRNRVTDRYFRIQEVLKHARHFWGRKNRCYRLAVRTVIRAFVKCTKARYLKKKNMRTVSVDPGHPPASALAAPAFLRRDPASVQPPGHPQPLPFIPCFETPTNYVAPQANCGTSVLPPRRHPHCHPLLQPLARATAEPP

 

24