Homology vs DNA |
Query= Contig-U16177-1 (Contig-U16177-1Q) /CSM_Contig/Contig-U16177-1Q.Seq.d (1161 letters)
Database: ddbj_B 98,226,423 sequences; 98,766,808,389 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AC116982) Dictyostelium discoideum chromosome 2 map 3622643... 708 0.0 2 (BJ414629) Dictyostelium discoideum cDNA clone:ddv19l19, 5' ... 708 0.0 2 (BJ434012) Dictyostelium discoideum cDNA clone:ddv23j17, 3' ... 866 0.0 1 (BJ425683) Dictyostelium discoideum cDNA clone:ddv56c13, 5' ... 866 0.0 1 (BJ415757) Dictyostelium discoideum cDNA clone:ddv23j17, 5' ... 866 0.0 1 (BJ444480) Dictyostelium discoideum cDNA clone:ddv56c13, 3' ... 844 0.0 1 (C90647) Dictyostelium discoideum slug cDNA, clone SSI266. 815 0.0 1 (C23672) Dictyostelium discoideum gamete cDNA, clone FC-AB06. 561 0.0 2 (AU284841) Dictyostelium discoideum gamete cDNA clone:FC-BM2... 793 0.0 1 (C91004) Dictyostelium discoideum slug cDNA, clone SSJ556. 789 0.0 1 (AU262187) Dictyostelium discoideum vegetative cDNA clone:VS... 680 0.0 1 (BJ444331) Dictyostelium discoideum cDNA clone:ddv56d02, 3' ... 585 e-162 1 (AU054184) Dictyostelium discoideum slug cDNA, clone SLK886. 515 e-141 1 (AU060680) Dictyostelium discoideum slug cDNA, clone SLK886. 513 e-141 1 (AU074119) Dictyostelium discoideum slug cDNA, clone SSJ556. 476 e-130 1 (BJ432805) Dictyostelium discoideum cDNA clone:ddv19l19, 3' ... 369 2e-97 1 (AU265462) Dictyostelium discoideum vegetative cDNA clone:VS... 232 2e-56 1 (AU265461) Dictyostelium discoideum vegetative cDNA clone:VS... 232 2e-56 1 (EC761082) PSE00006879 rw_mgpallid Polysphondylium pallidum ... 70 6e-31 3 (EC762363) PSE00002380 rw_mgpallid Polysphondylium pallidum ... 70 1e-21 3 (EC760693) PSE00008329 rw_mgpallid Polysphondylium pallidum ... 70 7e-18 2 (EC761809) PSE00002512 rw_mgpallid Polysphondylium pallidum ... 70 2e-07 1 (EH614324) EST_CSP005xl17f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH614070) EST_CSP004xh24f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH614133) EST_CSP005xg09f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH614093) EST_CSP004xn14f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH614162) EST_CSP005xm05f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH614161) EST_CSP005xm03f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH615060) EST_CSP008xe14f1.ab1 EST_CSP Nicotiana tabacum cD... 56 2e-06 2 (EH615033) EST_CSP008xi21f1.ab1 EST_CSP Nicotiana tabacum cD... 56 3e-06 2 (EH615079) EST_CSP008xh11f1.ab1 EST_CSP Nicotiana tabacum cD... 56 3e-06 2 (EB678628) KG9B.105A23F.051128T7 KG9B Nicotiana tabacum cDNA... 56 3e-06 2 (DW002657) KR3B.103I22F.051108T7 KR3B Nicotiana tabacum cDNA... 56 4e-06 2 (EB430929) KL5B.111D13F.060117T7 KL5B Nicotiana tabacum cDNA... 56 4e-06 2 (EB683923) KR3B.113O03F.060119T7 KR3B Nicotiana tabacum cDNA... 56 4e-06 2 (EB693662) NecGex_038C09 Ornamental tobacco (LxS8) Stage 12 ... 56 4e-06 2 (EB694745) NecGex_057G06 Ornamental tobacco (LxS8) Stage 12 ... 56 4e-06 2 (EB683317) KR3B.112D18F.060119T7 KR3B Nicotiana tabacum cDNA... 56 4e-06 2 (EB695622) NecGex_070A02 Ornamental tobacco (LxS8) Stage 12 ... 56 4e-06 2 (BQ588323) E012308-024-008-F12-SP6 MPIZ-ADIS-024-leaf Beta v... 54 4e-05 2 (BQ592162) E012696-024-021-K06-SP6 MPIZ-ADIS-024-developing ... 50 5e-05 2 (FG343236) SF_90-208R Bv_T0 Beta vulgaris subsp. vulgaris cD... 54 5e-05 2 (CV301618) MM10_C09 Young roots probed with 3 week old root ... 54 5e-05 2 (EG552289) MM04F20_RP Sugar Beet germination cDNA library Be... 54 5e-05 2 (EG552173) MM04F20_XP Sugar Beet germination cDNA library Be... 54 5e-05 2 (EG550439) MM05K02_XP Sugar Beet germination cDNA library Be... 54 5e-05 2 (FG345004) SF_08-e01 Bv_T1 Beta vulgaris subsp. vulgaris cDN... 50 5e-05 2 (EG550473) MM05E02_XP Sugar Beet germination cDNA library Be... 54 6e-05 2 (EG549541) MM02G05_RP Sugar Beet germination cDNA library Be... 54 1e-04 2 (EG550815) MM01B03_RP Sugar Beet germination cDNA library Be... 54 1e-04 2 (EG549435) MM01B03_XP Sugar Beet germination cDNA library Be... 54 1e-04 2 (EG550810) MM01F05_RP Sugar Beet germination cDNA library Be... 54 1e-04 2 (EG012316) STDB003A10u STDB Solanum tuberosum cDNA clone STD... 48 2e-04 2 (EL775684) PUNC685TV Pythium ultimum ESTs Pythium ultimum DA... 60 2e-04 1 (EG552600) MM01M11_XP Sugar Beet germination cDNA library Be... 60 2e-04 1 (FF059142) 493450_1511_0151 Pythium ultimum ESTs Pythium ult... 60 2e-04 1 (FF053218) 452403_1909_2171 Pythium ultimum ESTs Pythium ult... 60 2e-04 1 (FF049733) 434518_0493_1332 Pythium ultimum ESTs Pythium ult... 60 2e-04 1 (FF042382) 401333_1762_1091 Pythium ultimum ESTs Pythium ult... 60 2e-04 1 (FE975290) 053194_1552_3394 Pythium ultimum ESTs Pythium ult... 60 2e-04 1 (FH336373) CHO_OF4592xo06r1.ab1 CHO_OF4 Nicotiana tabacum ge... 48 6e-04 2 (EB691143) NecGex_177A10 Ornamental tobacco (LxS8) Stage 6 F... 48 7e-04 2 (EB690714) NecGex_156E04 Ornamental tobacco (LxS8) Stage 6 F... 48 7e-04 2 (AU261665) Dictyostelium discoideum vegetative cDNA clone:VS... 58 8e-04 1 (DW004890) KR3B.109P24F.051111T7 KR3B Nicotiana tabacum cDNA... 48 8e-04 2 (EH623315) CHO_SL014xi07f1.ab1 CHO_SL Nicotiana tabacum cDNA... 48 8e-04 2 (EB434819) TL13.108F13F.060315T7 TL13 Nicotiana tabacum cDNA... 48 8e-04 2 (EB429072) KL5B.001D15F.050901T7 KL5B Nicotiana tabacum cDNA... 48 8e-04 2 (FH129815) CHO_OF3500xo11f1.ab1 CHO_OF3 Nicotiana tabacum ge... 48 0.001 2 (AM824840) Nicotiana tabacum EST, clone nt002307053. 56 0.003 1 (CB080831) qp48g09.b1 Hedyotis terminalis flower - Stage 2 (... 56 0.003 1 (EC634451) AME00005444 Allomyces macrogynus Company Allomyce... 42 0.009 2 (EC634170) AME00000974 Allomyces macrogynus Company Allomyce... 42 0.009 2 (EC635863) AME00005576 Regular, Homemade 1-5kb (lib2_am) All... 42 0.009 2 (EG549641) MM02G05_XP Sugar Beet germination cDNA library Be... 54 0.012 1 (DW710854) EST034335 Trichophyton rubrum cDNA library 8 Tric... 54 0.012 1 (DW707391) EST030872 Trichophyton rubrum cDNA library 7 Tric... 54 0.012 1 (DW707249) EST030730 Trichophyton rubrum cDNA library 7 Tric... 54 0.012 1 (DW704875) EST028356 Trichophyton rubrum cDNA library 7 Tric... 54 0.012 1 (DW703665) EST027146 Trichophyton rubrum cDNA library 7 Tric... 54 0.012 1 (DW702318) EST025799 Trichophyton rubrum cDNA library 7 Tric... 54 0.012 1 (DW698497) EST021978 Trichophyton rubrum cDNA library 6 Tric... 54 0.012 1 (DW697875) EST021356 Trichophyton rubrum cDNA library 6 Tric... 54 0.012 1 (DW697345) EST020826 Trichophyton rubrum cDNA library 6 Tric... 54 0.012 1 (DW696350) EST019831 Trichophyton rubrum cDNA library 5 Tric... 54 0.012 1 (DW694551) EST018032 Trichophyton rubrum cDNA library 4 Tric... 54 0.012 1 (DW693512) EST016993 Trichophyton rubrum cDNA library 3 Tric... 54 0.012 1 (DW691111) EST014592 Trichophyton rubrum cDNA library 2 Tric... 54 0.012 1 (DW685934) EST009415 Trichophyton rubrum cDNA library 1 Tric... 54 0.012 1 (DW680003) EST003484 Trichophyton rubrum cDNA library 0 Tric... 54 0.012 1 (DW679605) EST003086 Trichophyton rubrum cDNA library 0 Tric... 54 0.012 1 (DW678597) EST002078 Trichophyton rubrum cDNA library 0 Tric... 54 0.012 1 (DW407135) EST001556 Trichophyton rubrum cDNA library Tricho... 54 0.012 1 (CV017109) tbt_010701 Normalized Nicotiana tabacum cDNA libr... 42 0.020 2 (BT031414) Phytophthora capsici clone CBOT109-D05 mRNA seque... 52 0.048 1 (AC216701) Solanum lycopersicum chromosome 7 clone C07SLe010... 52 0.048 1 (EG554007) to00238 Tomato CL5915 roots under different devel... 52 0.048 1 (EG553491) to01520 Tomato CL5915 roots under different devel... 52 0.048 1 (EG552937) to00145 Tomato CL5915 roots under different devel... 52 0.048 1 (EG012134) STDB003L16u STDB Solanum tuberosum cDNA clone STD... 52 0.048 1 (DY332350) OB_MEa0008D08.r OB_MEa Ocimum basilicum cDNA clon... 52 0.048 1 (DY332349) OB_MEa0008D08.f OB_MEa Ocimum basilicum cDNA clon... 52 0.048 1 (DB725219) Solanum lycopersicum cDNA, clone: LEFL2048M15, 5'... 52 0.048 1 (CV967046) PC016E11 infected tomato, center of lesion 3 dpi ... 52 0.048 1 (CV965704) PC026F09 infected tomato, center of lesion 3 dpi ... 52 0.048 1 (CV960835) PYrpcy_5750 mycelium, Plich medium Phytophthora i... 52 0.048 1 (CV960416) PXrpxc_8849 mycelium, starved in water Phytophtho... 52 0.048 1 (CV960399) PXrpxc_8829 mycelium, starved in water Phytophtho... 52 0.048 1 (CV959791) PXrpxc_8033 mycelium, starved in water Phytophtho... 52 0.048 1 (CV959251) PXrpxc_7072 mycelium, starved in water Phytophtho... 52 0.048 1 (CV958926) PXrpxc_6680 mycelium, starved in water Phytophtho... 52 0.048 1 (CV958921) PXrpxc_6675 mycelium, starved in water Phytophtho... 52 0.048 1 (CV958356) PXrpxc_5990 mycelium, starved in water Phytophtho... 52 0.048 1 (CV958149) PXrpxc_5754 mycelium, starved in water Phytophtho... 52 0.048 1 (CV957353) PXrpxc_4717 mycelium, starved in water Phytophtho... 52 0.048 1 (CV957056) PXrpxc_4384 mycelium, starved in water Phytophtho... 52 0.048 1 (CV956825) PXrpxc_4131 mycelium, starved in water Phytophtho... 52 0.048 1 (CV955588) PXrpxc_2563 mycelium, starved in water Phytophtho... 52 0.048 1 (CV955477) PXrpxc_2420 mycelium, starved in water Phytophtho... 52 0.048 1 (CV955041) PXrpxc_1890 mycelium, starved in water Phytophtho... 52 0.048 1 (CV954278) PXrpxc_0979 mycelium, starved in water Phytophtho... 52 0.048 1 (CV954191) PXrpxc_0673 mycelium, starved in water Phytophtho... 52 0.048 1 (CV953623) PWrpwa_0324 mycelium, infection mimic Phytophthor... 52 0.048 1 (CV953441) PWrpwa_0120 mycelium, infection mimic Phytophthor... 52 0.048 1 (CV952634) PVrpvb_7003 zoospores, purified Phytophthora infe... 52 0.048 1 (CV952158) PVrpvb_6211 zoospores, purified Phytophthora infe... 52 0.048 1 (CV952143) PVrpvb_5992 zoospores, purified Phytophthora infe... 52 0.048 1 (CV951762) PVrpvb_5553 zoospores, purified Phytophthora infe... 52 0.048 1 (CV950969) PVrpvb_4554 zoospores, purified Phytophthora infe... 52 0.048 1 (CV950585) PVrpvb_3919 zoospores, purified Phytophthora infe... 52 0.048 1 (CV949970) PVrpvb_3153 zoospores, purified Phytophthora infe... 52 0.048 1 (CV948539) PVrpvb_12024 zoospores, purified Phytophthora inf... 52 0.048 1 (CV948228) PVrpvb_11670 zoospores, purified Phytophthora inf... 52 0.048 1 (CV947621) PVrpvb_10904 zoospores, purified Phytophthora inf... 52 0.048 1 (CV947309) PVrpvb_10464 zoospores, purified Phytophthora inf... 52 0.048 1 (CV947296) PVrpvb_10450 zoospores, purified Phytophthora inf... 52 0.048 1 (CV946925) PVrpvb_10005 zoospores, purified Phytophthora inf... 52 0.048 1 (CV946822) PVrpvb_0587 zoospores, purified Phytophthora infe... 52 0.048 1 (CV941773) PMrpct_4329 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV940985) PMrpct_3321 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV940799) PMrpct_3118 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV939535) PMrpct_1124 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV937659) PMrpcm_7487 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV937098) PMrpcm_6829 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV937092) PMrpcm_6822 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV936882) PMrpcm_6467 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV936154) PMrpcm_5513 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV936132) PMrpcm_5486 mating of 88069 (A1) and 618 (A2) Phy... 52 0.048 1 (CV931930) PM060H2 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV931871) PM060C1 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV931035) PM049D1 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV930446) PM041F10 mating of 88069 (A1) and 618 (A2) Phytop... 52 0.048 1 (CV929166) PM024E4 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV929123) PM024A7 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV929075) PM023D8 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV929040) PM023A5 mating of 88069 (A1) and 618 (A2) Phytoph... 52 0.048 1 (CV928741) PL014D10 mycelium, H2O2-treated Phytophthora infe... 52 0.048 1 (CV928472) PL010H3 mycelium, H2O2-treated Phytophthora infes... 52 0.048 1 (CV928328) PL009B2 mycelium, H2O2-treated Phytophthora infes... 52 0.048 1 (CV928316) PL009A1 mycelium, H2O2-treated Phytophthora infes... 52 0.048 1 (CV927942) PL004C3 mycelium, H2O2-treated Phytophthora infes... 52 0.048 1 (CV927552) PK009C10 mycelium, heat treated Phytophthora infe... 52 0.048 1 (CV927508) PK008G9 mycelium, heat treated Phytophthora infes... 52 0.048 1 (CV927015) PK002D4 mycelium, heat treated Phytophthora infes... 52 0.048 1 (CV925937) PJ039D12 sporangia, purified Phytophthora infesta... 52 0.048 1 (CV925517) PJ034F2 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925457) PJ033H7 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925429) PJ033F1 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925393) PJ033B3 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925188) PJ030F6 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925119) PJ029F6 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV925086) PJ029C9 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV924341) PJ019E12 sporangia, purified Phytophthora infesta... 52 0.048 1 (CV924141) PJ017A1 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV923857) PJ013E2 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV923654) PJ011A7 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV923640) PJ010F9 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV923376) PJ007B8 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV923327) PJ006F3 sporangia, purified Phytophthora infestan... 52 0.048 1 (CV922650) PHrpch_2437 cysts, germinating Phytophthora infes... 52 0.048 1 (CV922568) PHrpch_2040 cysts, germinating Phytophthora infes... 52 0.048 1 (CV921707) PHrpch_0793 cysts, germinating Phytophthora infes... 52 0.048 1 (CV920912) PH051D4 cysts, germinating Phytophthora infestans... 52 0.048 1 (CV918850) PH013F9 cysts, germinating Phytophthora infestans... 52 0.048 1 (CV918848) PH013F7 cysts, germinating Phytophthora infestans... 52 0.048 1 (CV918639) PH010F9 cysts, germinating Phytophthora infestans... 52 0.048 1 (CV917881) PG020E12 sporangia, germinating Phytophthora infe... 52 0.048 1 (CV917663) PG017H10 sporangia, germinating Phytophthora infe... 52 0.048 1 (CV917593) PG016H7 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917579) PG016G4 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917400) PG014G2 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917255) PG013B2 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917245) PG013A4 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917239) PG012H8 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV917073) PG010H10 sporangia, germinating Phytophthora infe... 52 0.048 1 (CV916790) PG007G1 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV916403) PG002B4 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV916324) PG001C6 sporangia, germinating Phytophthora infes... 52 0.048 1 (CV916129) PF059A2 sporangia, cleaving Phytophthora infestan... 52 0.048 1 (CV914026) PF024B12 sporangia, cleaving Phytophthora infesta... 52 0.048 1 (CV913701) PF020D4 sporangia, cleaving Phytophthora infestan... 52 0.048 1 (CV913048) PF012D8 sporangia, cleaving Phytophthora infestan... 52 0.048 1 (CV912400) PF004D7 sporangia, cleaving Phytophthora infestan... 52 0.048 1 (CV912223) PF002C6 sporangia, cleaving Phytophthora infestan... 52 0.048 1 (CV909933) PE007H11 mycelium, carbon starvation Phytophthora... 52 0.048 1 (CV909523) PE003A1 mycelium, carbon starvation Phytophthora ... 52 0.048 1 (CV909210) PDrpcd_5147 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV909098) PDrpcd_4880 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV909082) PDrpcd_4859 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV908951) PDrpcd_4647 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV908917) PDrpcd_4593 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV908491) PDrpcd_3892 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV907412) PDrpcd_2362 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV907234) PDrpcd_2170 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV906835) PDrpcd_1720 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV906600) PDrpcd_1442 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV906439) PDrpcd_1246 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV906408) PDrpcd_1212 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV905921) PDrpcd_0344 mycelium, nitrogen starvation Phytoph... 52 0.048 1 (CV905567) PDpcd_1246 mycelium, nitrogen starvation Phytopht... 52 0.048 1 (CV904920) PDpcd_0344 mycelium, nitrogen starvation Phytopht... 52 0.048 1 (CV904610) PD049E8 mycelium, nitrogen starvation Phytophthor... 52 0.048 1 (CV904381) PD046C11 mycelium, nitrogen starvation Phytophtho... 52 0.048 1 (CV903364) PD032H4 mycelium, nitrogen starvation Phytophthor... 52 0.048 1 (CV902782) PD026C2 mycelium, nitrogen starvation Phytophthor... 52 0.048 1 (CV902639) PD024E7 mycelium, nitrogen starvation Phytophthor... 52 0.048 1 (CV902591) PD023H9 mycelium, nitrogen starvation Phytophthor... 52 0.048 1 (CV901651) PB055C1 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV900553) PB040C6 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV900535) PB039H12 mycelium, sporulating growth Phytophthor... 52 0.048 1 (CV899329) PB022G7 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV899176) PB020G3 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV899074) PB019E2 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV898718) PB014D10 mycelium, sporulating growth Phytophthor... 52 0.048 1 (CV898423) PB010G1 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV897911) PB004A11 mycelium, sporulating growth Phytophthor... 52 0.048 1 (CV897822) PB002F11 mycelium, sporulating growth Phytophthor... 52 0.048 1 (CV897701) PB001D2 mycelium, sporulating growth Phytophthora... 52 0.048 1 (CV896873) PA046E11 mycelium, non-sporulating growth Phytoph... 52 0.048 1 (CV896816) PA045H2 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV895875) PA034F11 mycelium, non-sporulating growth Phytoph... 52 0.048 1 (CV895872) PA034F7 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV895557) PA031B5 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV895526) PA030G6 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV895287) PA027G6 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV894866) PA022G7 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV893911) PA011C7 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV893821) PA010B11 mycelium, non-sporulating growth Phytoph... 52 0.048 1 (CV893813) PA010B2 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CV893606) PA007E3 mycelium, non-sporulating growth Phytopht... 52 0.048 1 (CK717369) 17200 Swollen Stolon Solanum tuberosum cDNA, mRNA... 52 0.048 1 (AJ878345) Solanum tuberosum EST, clone M14. 52 0.048 1 (CF863888) psZS008xJ03f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF860518) psZG010xA05f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF860111) psZG008xK20f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF860075) psZG008xI20f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859881) psZG007xO04f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859777) psZG007xJ03f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859694) psZG007xE19f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859429) psZG006xG24f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859210) psZG005xI14f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859135) psZG005xC06f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF859127) psZG005xB10f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858988) psZG004xH11f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858816) psZG003xE01f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858745) psZG001xO09f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858739) psZG001xN19f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858638) psZG001xH11f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858607) psZG001xF17f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858540) psZG001xB09f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF858202) psMY010iA08r Agriculture Canada Phytophthora soja... 52 0.048 1 (CF858120) psMY008iH11r Agriculture Canada Phytophthora soja... 52 0.048 1 (CF857916) psMY006iB06r Agriculture Canada Phytophthora soja... 52 0.048 1 (CF855911) psML005xM21f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF854563) psMC012xN09f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF854476) psMC011xO18f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF854446) psMC011xN03f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF853331) psMC008xG23f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF853221) psMC008xB23f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF853000) psMC007xF17f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF852984) psMC007xE23f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF852952) psMC007xC24f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF852291) psMC004xL09f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF851956) psMC003xC02f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF851747) psMC001xJ24f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF851159) psMA018xF15f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF849142) psMA009xI22f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF848971) psMA008xP04f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF848838) psMA008xH04f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF848581) psMA007xD24f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF847755) psMA002xG19f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF846608) psHB039xE03f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF842680) psHB021xC14f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF842660) psHB021xA08f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF842400) psHB019xM23f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF841573) psHB015xB02f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF841377) psHB014xD16f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF840640) psHB009xK02f USDA-IFAFS:Expression of Phytophthor... 52 0.048 1 (CF754415) EST-77-2-32-G11.r.1 Preamplified custom cDNA libr... 52 0.048 1 (AI489222) EST247561 tomato ovary, TAMU Solanum lycopersicum... 52 0.048 1 (BW686492) Solanum lycopersicum cDNA, clone: FC06BB04, 5' en... 52 0.048 1 (BQ506820) EST614235 Generation of a set of potato cDNA clon... 52 0.048 1 (BQ506819) EST614234 Generation of a set of potato cDNA clon... 52 0.048 1 (BP905199) Solanum lycopersicum cDNA, clone: LB13CD03, 5' en... 52 0.048 1 (BP904966) Solanum lycopersicum cDNA, clone: LB12DH07, 5' en... 52 0.048 1 (BP904875) Solanum lycopersicum cDNA, clone: LB12CH11, 5' en... 52 0.048 1 (BP903088) Solanum lycopersicum cDNA, clone: LB02DC11, 5' en... 52 0.048 1 (BP896961) Solanum lycopersicum cDNA, clone: LA12AF02, 5' en... 52 0.048 1 (BP893675) Solanum lycopersicum cDNA, clone: FB13CF12, 5' en... 52 0.048 1 (BP892748) Solanum lycopersicum cDNA, clone: FB11AB09, 5' en... 52 0.048 1 (BP889983) Solanum lycopersicum cDNA, clone: FB02BA04, 5' en... 52 0.048 1 (BM404728) EST579055 potato roots Solanum tuberosum cDNA clo... 52 0.048 1 (BM404578) EST578905 potato roots Solanum tuberosum cDNA clo... 52 0.048 1 (BM113404) EST560940 potato roots Solanum tuberosum cDNA clo... 52 0.048 1 (BM109645) EST557181 potato roots Solanum tuberosum cDNA clo... 52 0.048 1 (BI432500) EST535261 P. infestans-challenged potato leaf, co... 52 0.048 1 (BI210734) EST528774 cTOS Solanum lycopersicum cDNA clone cT... 52 0.048 1 (BI204237) EST522277 cTOS Solanum lycopersicum cDNA clone cT... 52 0.048 1 (BI203454) EST521494 cTOS Solanum lycopersicum cDNA clone cT... 52 0.048 1 (BG643996) EST512190 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG629753) cC-esflcLEL29N11a1 Tomato flower library from a m... 52 0.048 1 (BG629603) cC-esflcLEL29F03a1 Tomato flower library from a m... 52 0.048 1 (BG596474) EST495152 cSTS Solanum tuberosum cDNA clone cSTS1... 52 0.048 1 (BG595004) EST493682 cSTS Solanum tuberosum cDNA clone cSTS9... 52 0.048 1 (BG589518) EST497360 P. infestans-challenged leaf Solanum tu... 52 0.048 1 (BG133771) EST466663 tomato crown gall Solanum lycopersicum ... 52 0.048 1 (BG130068) EST475714 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG129174) EST474820 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG128686) EST474332 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG126442) EST472088 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG126383) EST472029 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BG126336) EST471982 tomato shoot/meristem Solanum lycopersi... 52 0.048 1 (BF114194) EST441784 tomato root, plant at pre-anthesis Sola... 52 0.048 1 (BF113490) EST441080 tomato root, plant at pre-anthesis Sola... 52 0.048 1 (BE777291) MY-26-F-08 PinfestansMY Phytophthora infestans cD... 52 0.048 1 (BE776789) MY-20-D-11 PinfestansMY Phytophthora infestans cD... 52 0.048 1 (BE776340) MY-14-E-12 PinfestansMY Phytophthora infestans cD... 52 0.048 1 (BE775931) MY-08-H-01 PinfestansMY Phytophthora infestans cD... 52 0.048 1 (BE583879) 11-11C-HA PsojaeHA Glycine max/Phytophthora sojae... 52 0.048 1 (BE583771) 1-3G-HA PsojaeHA Glycine max/Phytophthora sojae m... 52 0.048 1 (BE582883) 10-8A-MY PsojaeMY Phytophthora sojae cDNA, mRNA s... 52 0.048 1 (BE582856) 8-11H-MY PsojaeMY Phytophthora sojae cDNA, mRNA s... 52 0.048 1 (BE582565) 6-6B-MY PsojaeMY Phytophthora sojae cDNA, mRNA se... 52 0.048 1 (FG057510) CBOU6497.fwd CBOU Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG057509) CBOU6497.rev CBOU Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG054345) CBOU484.fwd CBOU Phytophthora capsici LT1534 Myce... 52 0.048 1 (FG054344) CBOU484.rev CBOU Phytophthora capsici LT1534 Myce... 52 0.048 1 (FG048565) CBOU18219.fwd CBOU Phytophthora capsici LT1534 My... 52 0.048 1 (FG040980) CBOU13184.fwd CBOU Phytophthora capsici LT1534 My... 52 0.048 1 (FG040979) CBOU13184.rev CBOU Phytophthora capsici LT1534 My... 52 0.048 1 (FG035076) CBOT9912.fwd CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG032455) CBOT8325.fwd CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG032454) CBOT8325.rev CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG032278) CBOT8222.fwd CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG029193) CBOT6454.rev CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG027370) CBOT5431.fwd CBOT Phytophthora capsici LT1534 Myc... 52 0.048 1 (FG017215) CBOT15550.fwd CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG017214) CBOT15550.rev CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG014943) CBOT14307.fwd CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG014942) CBOT14307.rev CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG014228) CBOT13895.fwd CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG014227) CBOT13895.rev CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG008195) CBOT10489.fwd CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG008183) CBOT10482.fwd CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FG008182) CBOT10482.rev CBOT Phytophthora capsici LT1534 My... 52 0.048 1 (FE979281) 081751_1763_0877 Pythium ultimum ESTs Pythium ult... 52 0.048 1 (FE300366) CANP1580.fwd CANP_Daphnia_pulex_Log50_Library_2 D... 52 0.048 1 (FE300365) CANP1580.rev CANP_Daphnia_pulex_Log50_Library_2 D... 52 0.048 1 (AW626352) EST320259 tomato radicle, 5 d post-imbibition, Co... 52 0.048 1 (AW625582) EST319489 tomato radicle, 5 d post-imbibition, Co... 52 0.048 1 (AW624939) EST313768 tomato radicle, 5 d post-imbibition, Co... 52 0.048 1 (AW623728) EST321673 tomato flower buds 3-8 mm, Cornell Univ... 52 0.048 1 (AW623716) EST321661 tomato flower buds 3-8 mm, Cornell Univ... 52 0.048 1 (AW621960) EST312758 tomato root during/after fruit set, Cor... 52 0.048 1 (AW621215) EST312013 tomato root during/after fruit set, Cor... 52 0.048 1 (AW442755) EST307685 tomato mixed elicitor, BTI Solanum lyco... 52 0.048 1 (EY272425) BF01058B1B05.f1 Normalized subtracted keck librar... 52 0.048 1 (ES896017) LET098_2007-03-01/LET098_D02_005_1 Solanum lycope... 52 0.048 1 (ES894304) LET075_2007-01-31_1/LET075_G03_010_1 Solanum lyco... 52 0.048 1 (ES892315) LET046F8_2005-10-05_1/LET046F8_B03_1 Solanum lyco... 52 0.048 1 (ES890863) LET018F7_2005-09-29_1/LET018F7_F05_1 Solanum lyco... 52 0.048 1 (ES890780) LET017F7_2005-09-15_1/LET017F7_D03_1 Solanum lyco... 52 0.048 1 (AW219863) EST302346 tomato root during/after fruit set, Cor... 52 0.048 1 (AW219862) EST302345 tomato root during/after fruit set, Cor... 52 0.048 1 (AW038790) EST280746 tomato mixed elicitor, BTI Solanum lyco... 52 0.048 1 (EG549429) MM01J19_RP Sugar Beet germination cDNA library Be... 50 0.19 1 (DY865108) ApulSEQ002165 Aureobasidium pullulans pBluescript... 50 0.19 1 (DY863937) ApulSEQ18884 Aureobasidium pullulans pBluescript ... 50 0.19 1 (DY861638) ApulSEQ15365 Aureobasidium pullulans pBluescript ... 50 0.19 1 (DY859564) ApulSEQ12090 Aureobasidium pullulans pBluescript ... 50 0.19 1 (DY856485) ApulSEQ7243 Aureobasidium pullulans pBluescript (... 50 0.19 1 (DC586788) Diospyros kaki cDNA, clone: KA046_C04, 5' end, ex... 50 0.19 1 (CO741534) Hd_mx23_17C11_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CO741296) Hd_mx23_14E04_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CO508716) Hd_mx24_18H06_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CO508548) Hd_mx24_16H05_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CO508138) Hd_mx24_09F11_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CK326368) Hd_mx23_03G10_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CK326300) Hd_mx23_03A02_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (AJ703472) Zantedeschia aethiopica EST, clone J-18-8. 50 0.19 1 (AJ701344) Zantedeschia aethiopica EST, clone H-18-15. 50 0.19 1 (CF544417) Hd_mx17_65D03_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (CF076039) Hd_mx17_63C05_T7 Hypsibius dujardini mixed stage ... 50 0.19 1 (BU668497) MC01029H11 MC01 Sesamum indicum cDNA, mRNA sequence. 50 0.19 1 (BU668179) MC01023E02 MC01 Sesamum indicum cDNA, mRNA sequence. 50 0.19 1 (FM170449) Oryzias latipes EST, clone M092--D6_042. 50 0.19 1 (CA517466) KS09080H10 KS09 Capsicum annuum cDNA, mRNA sequence. 38 0.36 2 (CA517250) KS09076E06 KS09 Capsicum annuum cDNA, mRNA sequence. 38 0.42 2 (BM065378) KS07002H10 KS07 Capsicum annuum cDNA, mRNA sequence. 38 0.44 2 (AT001947) Antheraea yamamai posterior silkgland EST clone A... 46 0.49 2 (BW580385) Ciona savignyi cDNA, clone:csef050i05, 5'end, sin... 46 0.52 2 (CA516038) KS09050G04 KS09 Capsicum annuum cDNA, mRNA sequence. 38 0.54 2 (CA522065) KS11039G08 KS11 Capsicum annuum cDNA, mRNA sequence. 38 0.57 2 (CA832916) MCS013H07_151110 Ice plant Lambda Uni-Zap XR expr... 44 0.58 2 (BE034523) MJ02E08 MJ Mesembryanthemum crystallinum cDNA 5',... 44 0.73 2 (Z30162) S.tuberosum mRNA for 60S ribosomal protein L27. 48 0.74 1 (CE052122) tigr-gss-dog-17000358204067 Dog Library Canis lup... 48 0.74 1 (ES559355) GA0a15T3_E05.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES559293) GA0c10T3_A09.ab14910491ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES559153) GA0a20T3_E03.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES559115) GA0a19T3_F02.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES559095) GA0a19T32_G09.ab14610461ABI GONIO-CCMP-05 Goniomo... 48 0.74 1 (ES559092) GA0a19T32_F11.ab14610461ABI GONIO-CCMP-05 Goniomo... 48 0.74 1 (ES559036) GA0a18T3_C04.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES559005) GA0a17T3_F09.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES558975) GA0a17T3_B05.ab14610461ABI GONIO-CCMP-05 Goniomon... 48 0.74 1 (ES558948) GA0a16T32_F01.ab14610461ABI GONIO-CCMP-05 Goniomo... 48 0.74 1 (ES558736) GA0a11T32_g3.ab1 GONIO-CCMP-05 Goniomonas cf. pac... 48 0.74 1 (ES558683) GA0A10T3_C03.ab1 GONIO-CCMP-05 Goniomonas cf. pac... 48 0.74 1 (ES558627) GA0a9T3c3.ab1 GONIO-CCMP-05 Goniomonas cf. pacifi... 48 0.74 1 (ES558276) GA0a3c07T71_20040126.ab1 GONIO-CCMP-05 Goniomonas... 48 0.74 1 (ES558264) GA0a3M13R_H04.ab1 GONIO-CCMP-05 Goniomonas cf. pa... 48 0.74 1 (ES558206) GA0a2b06T31.ab1 GONIO-CCMP-05 Goniomonas cf. paci... 48 0.74 1 (EH057547) THL52h-2957 cDNA library of Tamarix hispida leave... 48 0.74 1 (EH056529) THL52h-2040 cDNA library of Tamarix hispida leave... 48 0.74 1 (EH055255) THL52h-894 cDNA library of Tamarix hispida leaves... 48 0.74 1 (EG973611) THCK-2385 Tamarix hispida roots Tamarix hispida c... 48 0.74 1 (EG972649) THCK-1519 Tamarix hispida roots Tamarix hispida c... 48 0.74 1 (EG971596) THCK-572 Tamarix hispida roots Tamarix hispida cD... 48 0.74 1 (EG966504) TH24-1189 Tamarix hispida roots Tamarix hispida c... 48 0.74 1 (EG013389) SDBT001J05x SDBT Solanum tuberosum cDNA clone SDB... 48 0.74 1 (EG010161) SSBT004M09x SSBT Solanum tuberosum cDNA clone SSB... 48 0.74 1 (EE683291) WFes0013285 Daphnia pDNR-LIB Library HCGSest1 Dap... 48 0.74 1 (EE682221) WFes0013708 Daphnia pDNR-LIB Library HCGSest1 Dap... 48 0.74 1 (EE199589) CC-F01_016_M09 Cherry of different development st... 48 0.74 1 (EE198965) CC-F01_014_I22 Cherry of different development st... 48 0.74 1 (EE197392) CC-F01_008_N04 Cherry of different development st... 48 0.74 1 (EE192671) CC-L01_013_D02 Coffea young leaves Coffea canepho... 48 0.74 1 (EB435303) TL13.110E04F.060320T7 TL13 Nicotiana tabacum cDNA... 48 0.74 1 (DV969164) GC07171 Gracilaria changii cDNA library Gracilari... 48 0.74 1 (DV707074) CGN-54682 Cherry of Early Development Stage Coffe... 48 0.74 1 (DV706543) CGN-53993 Cherry of Early Development Stage Coffe... 48 0.74 1 (DV704609) CGN-51448 Cherry of Early Development Stage Coffe... 48 0.74 1 (DV701207) CGN-47357 Seed of Late Development Stage Coffea c... 48 0.74 1 (DV699228) CGN-45019 Seed of Late Development Stage Coffea c... 48 0.74 1 (DV696662) CGN-41902 Leaf Coffea canephora cDNA clone cccl27... 48 0.74 1 (DV694178) CGN-38576 Leaf Coffea canephora cDNA clone cccl31... 48 0.74 1 (DV688627) CGN-31376 Leaf Coffea canephora cDNA clone cccl23... 48 0.74 1 (DV680215) CGN-18751 Seed of Middle Development Stage Coffea... 48 0.74 1 (DV676704) CGN-13819 Pericarp Coffea canephora cDNA clone cc... 48 0.74 1 (DV668114) CGN-6628 Pericarp Coffea canephora cDNA clone ccc... 48 0.74 1 (DV626122) 96547.1 Cold Sweetening C Solanum tuberosum cDNA ... 48 0.74 1 (DV624960) 95249.1 Cold Sweetening C Solanum tuberosum cDNA ... 48 0.74 1 (DV624105) 93602.1 Cold Sweetening C Solanum tuberosum cDNA ... 48 0.74 1 (DV622715) 92096.1 Cold Sweetening C Solanum tuberosum cDNA ... 48 0.74 1 (DT603823) aam01-37ms1-g05 Aam01 Acorus americanus cDNA clon... 48 0.74 1 (DT576970) aam01-45ms1-i10 Aam01 Acorus americanus cDNA clon... 48 0.74 1 (DN941913) 3771.2 Tuber Skin Solanum tuberosum cDNA clone 37... 48 0.74 1 (DN941377) 55821.2 After-Cooking Darkening C Solanum tuberos... 48 0.74 1 (DN849442) 13150.2 Stolon Solanum tuberosum cDNA clone 13150... 48 0.74 1 (DN743618) 94303.1 Full Length Mixed Tuber Solanum tuberosum... 48 0.74 1 (DN590630) 91602.1 Late Blight-Challenged Tubers Solanum tub... 48 0.74 1 (DN590191) 91028.1 Late Blight-Challenged Tubers Solanum tub... 48 0.74 1 (AM717623) Cucumis melo subsp. melo EST, clone PS_06-A12-M13R. 48 0.74 1 (CX700303) 87162.1 Stolon Solanum tuberosum cDNA clone 87162... 48 0.74 1 (CX699856) 86629.1 Stolon Solanum tuberosum cDNA clone 86629... 48 0.74 1 (CV899665) PB027F8 mycelium, sporulating growth Phytophthora... 48 0.74 1 (CV651557) 75476.1 Low Molecular Weight Solanum tuberosum cD... 48 0.74 1 (CV501507) 66020.1 Mixed Leaf Solanum tuberosum cDNA clone 6... 48 0.74 1 (CV501380) 65885.1 Mixed Leaf Solanum tuberosum cDNA clone 6... 48 0.74 1 (CV497136) 61304.1 Mixed Leaf Solanum tuberosum cDNA clone 6... 48 0.74 1 (CV495976) 73640.1 Cold Sweetening B Solanum tuberosum cDNA ... 48 0.74 1 (CV493861) 38415.1 Cold Sweetening B Solanum tuberosum cDNA ... 48 0.74 1 (CV493316) 37688.1 Cold Sweetening B Solanum tuberosum cDNA ... 48 0.74 1 (CV492157) 36133.1 Cold Sweetening B Solanum tuberosum cDNA ... 48 0.74 1 (CV477758) 57686.1 Developing Tubers Solanum tuberosum cDNA ... 48 0.74 1 (CV473870) 22161.1 Developing Tubers Solanum tuberosum cDNA ... 48 0.74 1 (CV469668) 42368.1 Common Scab-Challenged Tubers Solanum tub... 48 0.74 1 (CV431273) 55424.1 After-Cooking Darkening C Solanum tuberos... 48 0.74 1 (CV431074) 55032.1 After-Cooking Darkening C Solanum tuberos... 48 0.74 1 (CV430943) 54794.1 After-Cooking Darkening C Solanum tuberos... 48 0.74 1 (CV429901) 52828.1 After-Cooking Darkening C Solanum tuberos... 48 0.74 1 (CV286747) 67797.1 After-Cooking Darkening A Solanum tuberos... 48 0.74 1 (CN516909) 548.1 Tuber Skin Solanum tuberosum cDNA clone 548... 48 0.74 1 (CN516823) 5191.1 Tuber Skin Solanum tuberosum cDNA clone 51... 48 0.74 1 (CN516817) 5185.1 Tuber Skin Solanum tuberosum cDNA clone 51... 48 0.74 1 (CN515685) 3787.1 Tuber Skin Solanum tuberosum cDNA clone 37... 48 0.74 1 (CN515671) 3771.1 Tuber Skin Solanum tuberosum cDNA clone 37... 48 0.74 1 (CN515005) 2951.1 Tuber Skin Solanum tuberosum cDNA clone 29... 48 0.74 1 (CN514815) 2720.1 Tuber Skin Solanum tuberosum cDNA clone 27... 48 0.74 1
>(AC116982) Dictyostelium discoideum chromosome 2 map 3622643-3879522 strain AX4, complete sequence. Length = 256879
Score = 708 bits (357), Expect(2) = 0.0 Identities = 357/357 (100%) Strand = Plus / Plus
Query: 129 gataaacattcagttaaagctagtattagtgttggtgtaccaaaaaataatgaaaaggtt 188 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132257 gataaacattcagttaaagctagtattagtgttggtgtaccaaaaaataatgaaaaggtt 132316
Query: 189 ttaacaagaattgaaaatgttaaaggtataatcggttgtattcaattggtatcaggtcat 248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132317 ttaacaagaattgaaaatgttaaaggtataatcggttgtattcaattggtatcaggtcat 132376
Query: 249 tatttaatgatattcaaagaacataatcatgttgcaactgtgacaggtaagaaaatctat 308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132377 tatttaatgatattcaaagaacataatcatgttgcaactgtgacaggtaagaaaatctat 132436
Query: 309 caaatgaaagatgtcgaattgattccattctttccaaatcagcaatcactagtatcaatc 368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132437 caaatgaaagatgtcgaattgattccattctttccaaatcagcaatcactagtatcaatc 132496
Query: 369 cccgatcaagatgccgaggaacaacatttatcgatgattagatggttattgtcgtcagag 428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132497 cccgatcaagatgccgaggaacaacatttatcgatgattagatggttattgtcgtcagag 132556
Query: 429 aatttctatttctcatatgactatgatttcactcttacacttcaaagacagtattca 485 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132557 aatttctatttctcatatgactatgatttcactcttacacttcaaagacagtattca 132613
Score = 196 bits (99), Expect(2) = 0.0 Identities = 99/99 (100%) Strand = Plus / Plus
Query: 503 aagcggatcgtcattaggcgagcgttgtgattcacgtttcttttggaacgaaaagtatgt 562 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132631 aagcggatcgtcattaggcgagcgttgtgattcacgtttcttttggaacgaaaagtatgt 132690
Query: 563 tacaattttaagtaaagagcatggtttgggtgactggat 601 ||||||||||||||||||||||||||||||||||||||| Sbjct: 132691 tacaattttaagtaaagagcatggtttgggtgactggat 132729
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 98226423 Number of Hits to DB: 906,978,756 Number of extensions: 49209873 Number of successful extensions: 3628485 Number of sequences better than 10.0: 751 Length of query: 1161 Length of database: 98,766,808,389 Length adjustment: 24 Effective length of query: 1137 Effective length of database: 96,409,374,237 Effective search space: 109617458507469 Effective search space used: 109617458507469 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|