Contig-U15312-1 |
Contig ID |
Contig-U15312-1 |
Contig update |
2004. 6.11 |
Contig sequence |
|
Gap |
no gap |
Contig length |
824 |
Chromosome number (1..6, M) |
1 |
Chromosome length |
4919822 |
Start point |
1340837 |
End point |
1340040 |
Strand (PLUS/MINUS) |
MINUS |
Number of clones |
6 |
Number of EST |
6 |
Link to clone list |
U15312 |
List of clone(s) |
|
Translated Amino Acid sequence |
|
Translated Amino Acid sequence (All Frames) |
|
own update |
2004. 6.23 |
Homology vs CSM-cDNA |
|
dna update |
2009. 1.18 |
Homology vs DNA |
Query= Contig-U15312-1 (Contig-U15312-1Q) /CSM_Contig/Contig-U15312-1Q.Seq.d (824 letters)
Database: ddbj_B 98,226,423 sequences; 98,766,808,389 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AU269204) Dictyostelium discoideum vegetative cDNA clone:VS... 549 0.0 4 (C24328) Dictyostelium discoideum gamete cDNA, clone FC-AR09. 545 0.0 4 (AU262450) Dictyostelium discoideum vegetative cDNA clone:VS... 539 0.0 4 (AU268994) Dictyostelium discoideum vegetative cDNA clone:VS... 470 0.0 5 (AU264745) Dictyostelium discoideum vegetative cDNA clone:VS... 500 0.0 4 (AU264757) Dictyostelium discoideum vegetative cDNA clone:VS... 391 0.0 5 (BJ357682) Dictyostelium discoideum cDNA clone:dda64j07, 3' ... 500 0.0 5 (BJ419547) Dictyostelium discoideum cDNA clone:ddv36n11, 5' ... 583 0.0 2 (AU268386) Dictyostelium discoideum vegetative cDNA clone:VS... 553 0.0 2 (AU268993) Dictyostelium discoideum vegetative cDNA clone:VS... 549 0.0 2 (AU269203) Dictyostelium discoideum vegetative cDNA clone:VS... 549 0.0 2 (AU264756) Dictyostelium discoideum vegetative cDNA clone:VS... 535 0.0 2 (BJ413129) Dictyostelium discoideum cDNA clone:ddv14d12, 5' ... 517 0.0 2 (AU264744) Dictyostelium discoideum vegetative cDNA clone:VS... 500 0.0 2 (BJ438124) Dictyostelium discoideum cDNA clone:ddv36n11, 3' ... 496 0.0 2 (BJ431471) Dictyostelium discoideum cDNA clone:ddv14d12, 3' ... 517 0.0 2 (C92075) Dictyostelium discoideum slug cDNA, clone SSD360. 299 0.0 4 (AU261409) Dictyostelium discoideum vegetative cDNA clone:VS... 291 0.0 5 (AU036915) Dictyostelium discoideum slug cDNA, clone SSB806. 634 0.0 2 (AU262081) Dictyostelium discoideum vegetative cDNA clone:VS... 291 0.0 4 (BJ409769) Dictyostelium discoideum cDNA clone:dds42o02, 3' ... 291 e-130 5 (AU072075) Dictyostelium discoideum slug cDNA, clone SSD360. 476 e-130 1 (AU268387) Dictyostelium discoideum vegetative cDNA clone:VS... 276 e-124 4 (BJ396513) Dictyostelium discoideum cDNA clone:dds42o02, 5' ... 291 e-103 3 (AU071564) Dictyostelium discoideum slug cDNA, clone SSB806. 131 2e-42 3 (AU265765) Dictyostelium discoideum vegetative cDNA clone:VS... 131 3e-33 2 (AU265764) Dictyostelium discoideum vegetative cDNA clone:VS... 131 3e-33 2 (BQ221040) AGENCOURT_7589397 NIH_MGC_72 Homo sapiens cDNA cl... 44 2e-04 2 (DC231243) Plasmodium berghei strain ANKA cDNA clone:SG02128... 52 0.007 2 (EB983959) 15510796 ZF40 Danio rerio cDNA clone 4233775, mRN... 42 0.008 2 (EB982958) 15471343 ZF40 Danio rerio cDNA clone 4214353, mRN... 42 0.015 2 (BG291630) 602385755F1 NIH_MGC_93 Homo sapiens cDNA clone IM... 44 0.018 2 (BG249669) 602319775F1 NIH_MGC_89 Homo sapiens cDNA clone IM... 42 0.025 2 (ES282196) PQ021H08.XT7 non-sporulating culture of P. brassi... 52 0.035 1 (EL704617) CBSU4069.rev NICHD_XGC_tropLimb_m Xenopus (Silura... 52 0.035 1 (EH368246) A10_j001_plate_171 j001 Nicotiana benthamiana cDN... 52 0.035 1 (EG703959) nbl41c10.y1 Rhesus monkey lens. Unnormalized (nbl... 52 0.035 1 (EG702386) nbl19b09.y1 Rhesus monkey lens. Unnormalized (nbl... 52 0.035 1 (EE737645) PMAH-aab37d12.g1 Lamprey_EST_Olfactory Petromyzon... 52 0.035 1 (DT458346) GH_ON36A07.r GH_ON Gossypium hirsutum cDNA clone ... 52 0.035 1 (DT458345) GH_ON36A07.f GH_ON Gossypium hirsutum cDNA clone ... 52 0.035 1 (DC002312) Xenopus laevis NBRP cDNA clone:rxlk58h14ex, 3' end. 52 0.035 1 (CV900342) PB037C10 mycelium, sporulating growth Phytophthor... 52 0.035 1 (CV895673) PA032E2 mycelium, non-sporulating growth Phytopht... 52 0.035 1 (CV870377) PDUts1078E11 Porcine testis cDNA library I Sus sc... 52 0.035 1 (CT679403) Danio rerio EST, clone ZF_mu_273a03 5'. 52 0.035 1 (CO868693) PDUts1012E02 Porcine testis cDNA library I Sus sc... 52 0.035 1 (AL589351) Homo sapiens mRNA; EST DKFZp451K1815_r1 (from cl... 52 0.035 1 (AL363535) Mus musculus mRNA; expressed sequence tag; clone ... 52 0.035 1 (CD892080) G118.119M21F010725 G118 Triticum aestivum cDNA cl... 52 0.035 1 (CB473912) sn77_G03.f1 sn Sus scrofa cDNA 5', mRNA sequence. 52 0.035 1 (CA394797) cs56e09.y1 Human Retinal pigment epithelium/choro... 52 0.035 1 (BI249596) 602996254F1 NCI_CGAP_Mam5 Mus musculus cDNA clone... 52 0.035 1 (BG168696) 602319949F1 NIH_MGC_89 Homo sapiens cDNA clone IM... 52 0.035 1 (BG024889) 602275811F1 NIH_MGC_85 Homo sapiens cDNA clone IM... 52 0.035 1 (EV223004) 0139710 Brassica napus Root - drought Brassica na... 52 0.035 1 (EV222987) 0139686 Brassica napus Root - drought Brassica na... 52 0.035 1 (EV216538) 0190804 Brassica napus Leaf - drought Brassica na... 52 0.035 1 (EV208473) 0177310 Brassica napus Leaf - drought Brassica na... 52 0.035 1 (BG258630) 602380348F1 NIH_MGC_92 Homo sapiens cDNA clone IM... 42 0.035 2 (BG180200) 602329803F1 NIH_MGC_91 Homo sapiens cDNA clone IM... 44 0.060 2 (DC215120) Plasmodium berghei strain ANKA cDNA clone:MG01731... 44 0.064 2 (DH111559) Oryzias latipes Fosmid clone:GOLWFno370_h09, reve... 46 0.065 2 (AC116919) Dictyostelium discoideum chromosome 2 map complem... 46 0.083 3 (DC225348) Plasmodium berghei strain ANKA cDNA clone:SG00254... 44 0.097 2 (CF871471) tric027xi07.b1 T.reesei mycelial culture, Version... 44 0.097 2 (EV149656) 0139433 Brassica napus Early anther Brassica napu... 44 0.10 2 (EV101412) 0093735 Brassica napus Leaf library Brassica napu... 42 0.10 2 (EV101715) 0094038 Brassica napus Leaf library Brassica napu... 42 0.10 2 (CB901698) tric027xi08 T.reesei mycelial culture, Version 3 ... 44 0.11 2 (CT666284) Danio rerio EST, clone ZF_mu_2i11 5'. 44 0.12 2 (EB984446) 15944982 ZF42 Danio rerio cDNA clone 4273017, mRN... 38 0.12 2 (BQ730570) AGENCOURT_8226877 NICHD_XGC_Emb4 Xenopus laevis c... 44 0.12 2 (CO422209) GGEZHT1025C05.g HT1 Gallus gallus cDNA clone GGEZ... 44 0.12 2 (AC159124) Medicago truncatula clone mth2-172h20, complete s... 50 0.14 1 (AC149207) Medicago truncatula chromosome 2 clone mte1-60l24... 50 0.14 1 (BD451177) Human Cancer Associated Gene Sequences and Polype... 50 0.14 1 (AB230041) Aspergillus oryzae cDNA, contig sequence: AoEST6928. 50 0.14 1 (CR342394) mte1-75I13RM1 BAC end, cultivar Jemalong A17 of M... 50 0.14 1 (EC782072) POAL11E02.F Colubridae snake Philodryas olfersii ... 50 0.14 1 (DT778080) 125616720 TH1 Tribolium castaneum cDNA clone 25O1... 50 0.14 1 (DN435911) LIB4217-016-R1-K1-F4 LIB4217 Canis lupus familiar... 50 0.14 1 (AM986499) Dicentrarchus labrax EST, 5'-end sequence, clone ... 50 0.14 1 (CX732479) oc31c04.y1 No3 mouse (cataract/retinal degenerati... 50 0.14 1 (AL363412) Mus musculus mRNA; expressed sequence tag; clone ... 50 0.14 1 (BQ829670) LL6in11248T7 AFT024-subtracted library Mus muscul... 50 0.14 1 (BI736640) 603360220F1 NIH_MGC_94 Mus musculus cDNA clone IM... 50 0.14 1 (BG164578) 602342136F1 NIH_MGC_89 Homo sapiens cDNA clone IM... 50 0.14 1 (BG024666) 602275473F1 NIH_MGC_85 Homo sapiens cDNA clone IM... 50 0.14 1 (BE807321) ss17g02.y1 Gm-c1047 Glycine max cDNA clone GENOME... 50 0.14 1 (AW780857) sl85d11.y1 Gm-c1037 Glycine max cDNA clone GENOME... 50 0.14 1 (AW734968) sk92f06.y1 Gm-c1035 Glycine max cDNA clone GENOME... 50 0.14 1 (AC116977) Dictyostelium discoideum chromosome 2 map 5515173... 34 0.14 8 (BF788820) 602110529F2 NCI_CGAP_Kid14 Mus musculus cDNA clon... 44 0.19 2 (DC226663) Plasmodium berghei strain ANKA cDNA clone:SG00660... 42 0.24 2 (CX458528) JGI_XZG27621.rev NIH_XGC_tropGas7 Xenopus (Silura... 38 0.25 2 (CX458529) JGI_XZG27621.fwd NIH_XGC_tropGas7 Xenopus (Silura... 38 0.26 2 (BI380499) BFLG1_002130 Amphioxus 5-6 hrs cDNA library (Name... 44 0.29 2 (CT702310) Danio rerio EST, clone ZF_mu_232i21 3'. 44 0.29 2 (FF461229) G50P6076RE11.T0 Acorn worm gastrula/neurula pCMVS... 44 0.31 2
>(AU269204) Dictyostelium discoideum vegetative cDNA clone:VSI768, 3' end single read. Length = 635
Score = 549 bits (277), Expect(4) = 0.0 Identities = 277/277 (100%) Strand = Plus / Plus
Query: 76 aacaaatataaatacaatgacaacacaagttccaaaaattaaatgggcagaaagaccaga 135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 aacaaatataaatacaatgacaacacaagttccaaaaattaaatgggcagaaagaccaga 60
Query: 136 ctttgtttatattacaattgaagcagatgttgaatctccagttgttaaattcgaatcaaa 195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ctttgtttatattacaattgaagcagatgttgaatctccagttgttaaattcgaatcaaa 120
Query: 196 caaaatttcattcgaaggtaaaggtaaagatggtaaacaatacgccttttcctatgattt 255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 caaaatttcattcgaaggtaaaggtaaagatggtaaacaatacgccttttcctatgattt 180
Query: 256 attcaaagaaatcgatgctgataaatcatcaactgatttcaaaacaagcagatacccaag 315 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 attcaaagaaatcgatgctgataaatcatcaactgatttcaaaacaagcagatacccaag 240
Query: 316 attaaaattagttaaaaaagatgccggtccatattgg 352 ||||||||||||||||||||||||||||||||||||| Sbjct: 241 attaaaattagttaaaaaagatgccggtccatattgg 277
Score = 291 bits (147), Expect(4) = 0.0 Identities = 150/151 (99%) Strand = Plus / Plus
Query: 352 ggaactttttattaaaagataaaaagacagacaagtttgttgaaaccgattggactcttt 411 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 276 ggaactttttattaaaagataaaaagaaagacaagtttgttgaaaccgattggactcttt 335
Query: 412 ggaaggatgaagatgaagtagaagaaaatgaagatgctggtaaattcggtaactttgata 471 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 336 ggaaggatgaagatgaagtagaagaaaatgaagatgctggtaaattcggtaactttgata 395
Query: 472 tgggtggcatggatatgcaacaaatgatgca 502 ||||||||||||||||||||||||||||||| Sbjct: 396 tgggtggcatggatatgcaacaaatgatgca 426
Score = 131 bits (66), Expect(4) = 0.0 Identities = 66/66 (100%) Strand = Plus / Plus
Query: 679 ctaaattaaactctgttgattaaataaatagtaataacacatatttatattcccacttta 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 540 ctaaattaaactctgttgattaaataaatagtaataacacatatttatattcccacttta 599
Query: 739 tccccc 744 |||||| Sbjct: 600 tccccc 605
Score = 48.1 bits (24), Expect(4) = 0.0 Identities = 24/24 (100%) Strand = Plus / Plus
Query: 594 aatttcgatgatatggatgatatg 617 |||||||||||||||||||||||| Sbjct: 455 aatttcgatgatatggatgatatg 478
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 98226423 Number of Hits to DB: 865,378,250 Number of extensions: 57242951 Number of successful extensions: 5283226 Number of sequences better than 10.0: 5060 Length of query: 824 Length of database: 98,766,808,389 Length adjustment: 24 Effective length of query: 800 Effective length of database: 100,704,341,533 Effective search space: 80563473226400 Effective search space used: 80563473226400 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|
protein update |
2009. 7.15 |
Homology vs Protein |
|
PSORT |
|
VS (DIR, S) |
0 |
VH (FL, L) |
1 |
VF (FL, S) |
0 |
AH (FL, L) |
1 |
AF (FL, S) |
0 |
SL (DIR, L) |
0 |
SS (DIR, S) |
2 |
SH (FL, L) |
1 |
SF (FL, S) |
0 |
CH (FL, L) |
0 |
CF (FL, S) |
0 |
FCL (DIR, L) |
0 |
FC (DIR, S) |
1 |
FC-IC (SUB) |
0 |