Contig-U15212-1 |
Contig ID |
Contig-U15212-1 |
Contig update |
2004. 6.11 |
Contig sequence |
|
Gap |
no gap |
Contig length |
666 |
Chromosome number (1..6, M) |
4 |
Chromosome length |
5430582 |
Start point |
3056274 |
End point |
3056888 |
Strand (PLUS/MINUS) |
PLUS |
Number of clones |
22 |
Number of EST |
26 |
Link to clone list |
U15212 |
List of clone(s) |
|
Translated Amino Acid sequence |
|
Translated Amino Acid sequence (All Frames) |
|
own update |
2004. 6.23 |
Homology vs CSM-cDNA |
|
dna update |
2009. 1.16 |
Homology vs DNA |
Query= Contig-U15212-1 (Contig-U15212-1Q) /CSM_Contig/Contig-U15212-1Q.Seq.d (666 letters)
Database: ddbj_B 98,226,423 sequences; 98,766,808,389 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AU270386) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU265300) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 9 (AU266474) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 9 (AU269049) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 9 (AU267801) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU267312) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 7 (AU270387) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 9 (AU269048) Dictyostelium discoideum vegetative cDNA clone:VS... 722 0.0 5 (AU265029) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU284868) Dictyostelium discoideum gamete cDNA clone:FC-BN2... 442 0.0 8 (AU262197) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU263084) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU267313) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU284860) Dictyostelium discoideum gamete cDNA clone:FC-BN1... 434 0.0 8 (AU269755) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 8 (AU267135) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 7 (AU262149) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 6 (AU268359) Dictyostelium discoideum vegetative cDNA clone:VS... 436 0.0 5 (AU265030) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 6 (AU262177) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 6 (AU269754) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 6 (AU267800) Dictyostelium discoideum vegetative cDNA clone:VS... 430 0.0 7 (AU262131) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 6 (AU265301) Dictyostelium discoideum vegetative cDNA clone:VS... 525 0.0 5 (AU267134) Dictyostelium discoideum vegetative cDNA clone:VS... 442 0.0 4 (AU262869) Dictyostelium discoideum vegetative cDNA clone:VS... 432 0.0 5 (AU266473) Dictyostelium discoideum vegetative cDNA clone:VS... 428 0.0 5 (AU271719) Dictyostelium discoideum gamete cDNA clone:FC-IC0... 198 e-136 6 (AU263379) Dictyostelium discoideum vegetative cDNA clone:VS... 111 e-109 5 (AU266599) Dictyostelium discoideum vegetative cDNA clone:VS... 188 2e-73 4 (EC762281) PSE00006396 rw_mgpallid Polysphondylium pallidum ... 72 3e-30 4 (AU264816) Dictyostelium discoideum vegetative cDNA clone:VS... 111 1e-25 2 (EC761470) PSE00006606 rw_mgpallid Polysphondylium pallidum ... 72 1e-23 3 (EC761376) PSE00006746 rw_mgpallid Polysphondylium pallidum ... 72 1e-23 3 (EC760795) PSE00002600 rw_mgpallid Polysphondylium pallidum ... 64 3e-21 4 (EC745890) PSE00005793 rw_mgpallid Polysphondylium pallidum ... 72 2e-20 2 (EC745780) PSE00007910 rw_mgpallid Polysphondylium pallidum ... 60 6e-14 2 (EH431701) NPE00000421 Neocallimastix patriciarum ZAP II cDN... 42 5e-10 4 (DN135516) tam56d06.y2 Hydra_EST_HyEch_JUMY_T2 Hydractinia e... 44 2e-08 4 (FE527672) Chr.00034 cDNA library of Chrysoperla nipponensis... 50 2e-08 2 (EC853604) HDE00001752 Hyperamoeba dachnaya Non-normalized (... 52 7e-07 2 (CU615718) Theobroma cacao, mRNA sequence (KZ0AAN4YM16FM1). 40 2e-06 3 (DN201501) USDA-FP_136592 Asian citrus psyllid Diaphorina ci... 38 5e-06 4 (FK257926) USDA-FP_193889 Asian citrus psyllid midgut (Hemip... 38 6e-06 4 (EC129194) HVE00002459 Hartmannella vermiformis Regular Smal... 52 1e-05 2 (EC130885) HVE00005656 Hartmannella vermiformis Normalized s... 52 2e-05 2 (CA755192) BR030015000_PLATE_D01_4_012.ab1 OA Oryza sativa J... 46 3e-05 3 (DN468128) USDA-FP_142110 Diaphorina citri Kuwayama (Hemipte... 34 3e-05 4 (AY967565) Schmidtea mediterranea clone NBE.2.01H mRNA seque... 62 3e-05 1 (DV448590) CV01025A1H04.f1 CV01-normalized library Manihot e... 62 3e-05 1 (DV441711) CV01005A1C08.f1 CV01-normalized library Manihot e... 62 3e-05 1 (DN313033) PL06014B1C01 cDNA from juvenile hermaphodites Sch... 62 3e-05 1 (DN310920) PL06008B2A09 cDNA from juvenile hermaphodites Sch... 62 3e-05 1 (DN309139) PL06003X1G04 cDNA from juvenile hermaphodites Sch... 62 3e-05 1 (DN308964) PL06001X1H04 cDNA from juvenile hermaphodites Sch... 62 3e-05 1 (DN303330) PL05002B2C11 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN302575) PL020002001A12 cDNA from sexually mature hermapho... 62 3e-05 1 (DN301333) PL04022A2A10 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN300806) PL04020B1B04 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN300685) PL04020A1E05 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN300319) PL04018B2G05 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN300270) PL04018B2B12 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN300229) PL04018B1G01 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN299905) PL04017B1E07 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN298812) PL04014A1B07 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN296313) PL04005B1G07 cDNA from sexually mature hermaphodi... 62 3e-05 1 (DN293684) PL030014B20C08 cDNA from sexually mature hermapho... 62 3e-05 1 (DN293638) PL030014B10G09 cDNA from sexually mature hermapho... 62 3e-05 1 (DN293570) PL030014B10A06 cDNA from sexually mature hermapho... 62 3e-05 1 (DN293562) PL030014A20H09 cDNA from sexually mature hermapho... 62 3e-05 1 (DN292928) PL030012A20C08 cDNA from sexually mature hermapho... 62 3e-05 1 (DN292300) PL030010A20E11 cDNA from sexually mature hermapho... 62 3e-05 1 (DN291617) PL030007B20H04 cDNA from sexually mature hermapho... 62 3e-05 1 (DN291294) PL030006B20B05 cDNA from sexually mature hermapho... 62 3e-05 1 (DN290839) PL030005A20A07 cDNA from sexually mature hermapho... 62 3e-05 1 (DN290540) PL030004A20E01 cDNA from sexually mature hermapho... 62 3e-05 1 (DN289538) PL030001A20B10 cDNA from sexually mature hermapho... 62 3e-05 1 (DQ673427) Diaphorina citri putative ribosomal protein L17 m... 34 4e-05 4 (CO539435) tai17a06.y1 HyEch JUMY T1 Hydractinia echinata cD... 44 4e-05 3 (DN467008) USDA-FP_140988 Diaphorina citri Kuwayama (Hemipte... 34 5e-05 4 (DN201947) USDA-FP_137038 Asian citrus psyllid Diaphorina ci... 34 6e-05 4 (DN202313) USDA-FP_137404 Asian citrus psyllid Diaphorina ci... 34 6e-05 4 (BW521784) Ciona savignyi cDNA, clone:csga070i08, 5'end, sin... 38 6e-05 3 (BW533844) Ciona savignyi cDNA, clone:csma079k12, 5'end, sin... 38 7e-05 3 (BW534675) Ciona savignyi cDNA, clone:csma082l22, 5'end, sin... 38 7e-05 3 (BW558089) Ciona savignyi cDNA, clone:cslv004i09, 3'end, sin... 38 7e-05 3 (BW535797) Ciona savignyi cDNA, clone:csma086h01, 5'end, sin... 38 8e-05 3 (EH431598) NPE00000757 Neocallimastix patriciarum ZAP II cDN... 42 8e-05 3 (BW564161) Ciona savignyi cDNA, clone:csma082l22, 3'end, sin... 38 9e-05 3 (BW565233) Ciona savignyi cDNA, clone:csma086h01, 3'end, sin... 38 9e-05 3 (EC744926) PSE00005601 rw_mgpallid Polysphondylium pallidum ... 60 1e-04 1 (FE856682) CAFU761.rev CAFU Pichia stipitis oxygen limited d... 46 2e-04 2 (FE856683) CAFU761.fwd CAFU Pichia stipitis oxygen limited d... 46 3e-04 2 (FE859799) CAFY1066.rev CAFY Pichia stipitis oxygen limited ... 46 3e-04 2 (FE846177) CAFI593.fwd CAFI Pichia stipitis aerobic dextrose... 46 3e-04 2 (FE846176) CAFI593.rev CAFI Pichia stipitis aerobic dextrose... 46 3e-04 2 (FE856664) CAFU751.rev CAFU Pichia stipitis oxygen limited d... 46 3e-04 2 (FE856134) CAFU469.rev CAFU Pichia stipitis oxygen limited d... 46 3e-04 2 (FE846059) CAFI529.fwd CAFI Pichia stipitis aerobic dextrose... 46 3e-04 2 (FE851967) CAFP1996.rev CAFP Pichia stipitis aerobic xylose ... 46 3e-04 2
>(AU270386) Dictyostelium discoideum vegetative cDNA clone:VSJ734, 5' end single read. Length = 605
Score = 442 bits (223), Expect(8) = 0.0 Identities = 223/223 (100%) Strand = Plus / Plus
Query: 153 agctaaagcttacttaaacaacgttttagcccatagagaatgtatcccattcagaagatt 212 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 147 agctaaagcttacttaaacaacgttttagcccatagagaatgtatcccattcagaagatt 206
Query: 213 caaaggtggtgtaggtcgtactggtcaagccaaaattttcggtaccagtcaaggtagatg 272 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 207 caaaggtggtgtaggtcgtactggtcaagccaaaattttcggtaccagtcaaggtagatg 266
Query: 273 gccaaagaaatctgttgaacacattttatcactcctccaaaatgctgaagccaacgctga 332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 267 gccaaagaaatctgttgaacacattttatcactcctccaaaatgctgaagccaacgctga 326
Query: 333 agctaagggtttaaatgttgaaaaactcaagatcgctcacgtt 375 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 327 agctaagggtttaaatgttgaaaaactcaagatcgctcacgtt 369
Score = 218 bits (110), Expect(8) = 0.0 Identities = 110/110 (100%) Strand = Plus / Plus
Query: 426 ggtcgtatcaatccatacatgtgttcaccatcaactgttgaattcatcctcacttgaagt 485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 418 ggtcgtatcaatccatacatgtgttcaccatcaactgttgaattcatcctcacttgaagt 477
Query: 486 tgaaaaagctgtcccaaaaccagctgaagaatccgcccaaaagaagaaat 535 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 478 tgaaaaagctgtcccaaaaccagctgaagaatccgcccaaaagaagaaat 527
Score = 188 bits (95), Expect(8) = 0.0 Identities = 95/95 (100%) Strand = Plus / Plus
Query: 58 aaaaatcctgcaaatctcgtggttctaacttaagaattcacttcaagaacaccagagaat 117 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 53 aaaaatcctgcaaatctcgtggttctaacttaagaattcacttcaagaacaccagagaat 112
Query: 118 cagctatggccatcaaaggtatgctcttaaccaga 152 ||||||||||||||||||||||||||||||||||| Sbjct: 113 cagctatggccatcaaaggtatgctcttaaccaga 147
Score = 103 bits (52), Expect(8) = 0.0 Identities = 52/52 (100%) Strand = Plus / Plus
Query: 375 ttcaagttcaacgtgctcaacaacaacgtagaagaacctacagagcacatgg 426 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 368 ttcaagttcaacgtgctcaacaacaacgtagaagaacctacagagcacatgg 419
Score = 52.0 bits (26), Expect(8) = 0.0 Identities = 26/26 (100%) Strand = Plus / Plus
Query: 537 ctgtcgccacccaagaaatctctgct 562 |||||||||||||||||||||||||| Sbjct: 528 ctgtcgccacccaagaaatctctgct 553
Score = 38.2 bits (19), Expect(8) = 0.0 Identities = 19/19 (100%) Strand = Plus / Plus
Query: 3 tgaaaattaaaaatgacaa 21 ||||||||||||||||||| Sbjct: 1 tgaaaattaaaaatgacaa 19
Score = 36.2 bits (18), Expect(8) = 0.0 Identities = 21/22 (95%) Strand = Plus / Plus
Query: 40 gaccccatccaacccagtaaaa 61 ||||||||||||||||| |||| Sbjct: 36 gaccccatccaacccagaaaaa 57
Score = 34.2 bits (17), Expect(8) = 0.0 Identities = 17/17 (100%) Strand = Plus / Plus
Query: 23 aaccagtttattcaaag 39 ||||||||||||||||| Sbjct: 20 aaccagtttattcaaag 36
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 98226423 Number of Hits to DB: 643,581,724 Number of extensions: 37869314 Number of successful extensions: 2864742 Number of sequences better than 10.0: 1507 Length of query: 666 Length of database: 98,766,808,389 Length adjustment: 24 Effective length of query: 642 Effective length of database: 100,704,341,533 Effective search space: 64652187264186 Effective search space used: 64652187264186 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|
protein update |
2009. 7.15 |
Homology vs Protein |
|
PSORT |
|
VS (DIR, S) |
18 |
VH (FL, L) |
0 |
VF (FL, S) |
0 |
AH (FL, L) |
0 |
AF (FL, S) |
0 |
SL (DIR, L) |
0 |
SS (DIR, S) |
0 |
SH (FL, L) |
0 |
SF (FL, S) |
0 |
CH (FL, L) |
0 |
CF (FL, S) |
0 |
FCL (DIR, L) |
0 |
FC (DIR, S) |
3 |
FC-IC (SUB) |
1 |