Contig-U02846-1 |
Contig ID |
Contig-U02846-1 |
Contig update |
2002. 9.13 |
Contig sequence |
|
Gap |
no gap |
Contig length |
1434 |
Chromosome number (1..6, M) |
- |
Chromosome length |
- |
Start point |
- |
End point |
- |
Strand (PLUS/MINUS) |
- |
Number of clones |
3 |
Number of EST |
6 |
Link to clone list |
U02846 |
List of clone(s) |
|
Translated Amino Acid sequence |
|
Translated Amino Acid sequence (All Frames) |
|
own update |
2004. 6. 9 |
Homology vs CSM-cDNA |
|
dna update |
2009. 5.23 |
Homology vs DNA |
Query= Contig-U02846-1 (Contig-U02846-1Q) /CSM_Contig/Contig-U02846-1Q.Seq.d (1434 letters)
Database: ddbj_A 102,105,510 sequences; 101,790,757,118 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(BJ371869) Dictyostelium discoideum cDNA clone:ddc10g01, 3' ... 392 0.0 3 (BJ344506) Dictyostelium discoideum cDNA clone:dda19f16, 3' ... 575 0.0 4 (C94186) Dictyostelium discoideum slug cDNA, clone SSK512. 575 0.0 4 (BJ358544) Dictyostelium discoideum cDNA clone:ddc10g01, 5' ... 321 e-108 2 (BJ327195) Dictyostelium discoideum cDNA clone:dda19f16, 5' ... 86 1e-25 2 (AU074370) Dictyostelium discoideum slug cDNA, clone SSK512. 92 5e-21 2 (AE014821) Plasmodium falciparum 3D7 chromosome 14 section 6... 52 7e-05 9 (M59474) Plasmodium falciparum asparagine-rich antigen Pfa35... 40 0.002 4 (AJ585374) Dictyostelium discoideum phg2 mRNA for Phagocytos... 38 0.002 3 (AL844509) Plasmodium falciparum chromosome 13. 38 0.010 10 (AM236321) Ascaris suum partial mRNA for 227 kDa spindle- an... 42 0.041 3 (AL844506) Plasmodium falciparum chromosome 7. 42 0.070 6 (AE014819) Plasmodium falciparum 3D7 chromosome 14 section 4... 38 0.073 8 (BJ375928) Dictyostelium discoideum cDNA clone:ddc20f15, 3' ... 40 0.073 2 (AL049181) Plasmodium falciparum DNA *** SEQUENCING IN PROGR... 40 0.074 10 (AL844501) Plasmodium falciparum strain 3D7, chromosome 1. 40 0.083 7 (AE014832) Plasmodium falciparum 3D7 chromosome 10 section 4... 38 0.085 8 (CI998686) Marsupenaeus japonicus cDNA, clone:YAQ02A01NGRM00... 34 0.095 3 (AM473415) Vitis vinifera contig VV78X028443.3, whole genome... 34 0.099 3 (AU263023) Dictyostelium discoideum vegetative cDNA clone:VS... 38 0.13 2 (CR382398) Plasmodium falciparum chromosome 6, complete sequ... 38 0.13 7 (AY232271) Dictyostelium discoideum putative protein Roco9 (... 40 0.14 3 (AC116986) Dictyostelium discoideum chromosome 2 map 2234041... 38 0.16 4 (AF362375) Dictyostelium discoideum histidine kinase DhkE (d... 38 0.19 5 (CR760666) Xenopus tropicalis finished cDNA, clone TEgg091l04. 50 0.24 1 (BC160493) Xenopus tropicalis BMS1 homolog, ribosome assembl... 50 0.24 1 (AC011231) Homo sapiens BAC clone RP11-13K3 from 2, complete... 50 0.24 1 (CR857217) Pongo abelii mRNA; cDNA DKFZp469H1622 (from clone... 50 0.24 1 (AY401239) Pan troglodytes HCM0824 gene, VIRTUAL TRANSCRIPT,... 50 0.24 1 (ER427789) 1092963762642 Global-Ocean-Sampling_GS-35-01-01-1... 50 0.24 1 (AM654593) Entamoeba moshkovskii FIC GSS, clone mosh015e06.q1k. 50 0.24 1 (EJ313882) 1095403254355 Global-Ocean-Sampling_GS-27-01-01-1... 50 0.24 1 (EJ123451) 1092343384102 Global-Ocean-Sampling_GS-27-01-01-1... 50 0.24 1 (EL818600) CBWN3908.g1 NICHD_XGC_tropTe1 Xenopus (Silurana) ... 50 0.24 1 (EE488252) SD7MrF11 YG/PR Prunus cerasus cDNA, mRNA sequence. 50 0.24 1 (DC187826) Xenopus (Silurana) tropicalis NBRP cDNA clone: st... 50 0.24 1 (DC157682) Xenopus (Silurana) tropicalis NBRP cDNA clone: rs... 50 0.24 1 (CX495710) JGI_XZG37758.rev NIH_XGC_tropGas7 Xenopus (Silura... 50 0.24 1 (CX477683) JGI_XZG20800.rev NIH_XGC_tropGas7 Xenopus (Silura... 50 0.24 1 (CX441630) JGI_XZG60685.rev NIH_XGC_tropGas7 Xenopus (Silura... 50 0.24 1 (CX427819) JGI_XZG18397.rev NIH_XGC_tropGas7 Xenopus (Silura... 50 0.24 1 (CX369181) JGI_XZT54928.rev NIH_XGC_tropTad5 Xenopus (Silura... 50 0.24 1 (CR411180) Xenopus tropicalis EST, clone TTbA028b01 3'. 50 0.24 1 (AL844507) Plasmodium falciparum chromosome 8. 38 0.25 7 (AC116956) Dictyostelium discoideum chromosome 2 map 1418423... 38 0.25 3 (BJ364369) Dictyostelium discoideum cDNA clone:ddc31p12, 5' ... 38 0.26 2 (AU270275) Dictyostelium discoideum vegetative cDNA clone:VS... 38 0.26 2 (AM661799) Entamoeba moshkovskii FIC GSS, clone mosh114g07.q1k. 34 0.27 3 (EL503883) A10_2526_302.AB1 Blood stage Plasmodium falciparu... 44 0.28 2 (GE408185) 293802092 Nasonia vitripennis Female Pupae Nasoni... 38 0.28 2 (EL502276) B08_PFLAB1-LARGE-PLATE13B.AB1 Blood stage Plasmod... 44 0.30 2 (AL929353) Plasmodium falciparum strain 3D7, chromosome 5, s... 38 0.30 9 (AC007051) Homo sapiens chromosome 3, clone hRPK.44_A_1, com... 40 0.32 4 (EL416144) CHCL4764.b1_H15.ab1 CHC(LMS) Texas blueweed Helia... 42 0.32 2 (AC176190) Strongylocentrotus purpuratus clone R3-3063P22, W... 38 0.34 6 (AU071298) Dictyostelium discoideum slug cDNA, clone SSB183. 40 0.36 2 (FM992690) Candida dubliniensis CD36 chromosome 3, complete ... 40 0.39 7 (AC007919) Homo sapiens 3 BAC RP11-408H1 (Roswell Park Cance... 40 0.41 4 (CR759876) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 38 0.43 5 (AC116979) Dictyostelium discoideum chromosome 2 map 6445720... 34 0.43 5 (AU261867) Dictyostelium discoideum vegetative cDNA clone:VS... 38 0.45 3 (AF102575) Dictyostelium discoideum cell surface protein DTF... 38 0.45 3 (CR354546) Zebrafish DNA sequence *** SEQUENCING CANCELLED *... 38 0.47 8 (AC005506) Plasmodium falciparum chromosome 12 clone PFYAC35... 34 0.50 11 (AC116984) Dictyostelium discoideum chromosome 2 map 2567470... 42 0.53 4 (AC116305) Dictyostelium discoideum chromosome 2 map 1005175... 40 0.53 3 (AC182709) Populus trichocarpa clone Pop1-85D11, complete se... 42 0.61 7 (AE014845) Plasmodium falciparum 3D7 chromosome 12, section ... 38 0.61 8 (EL502447) C05_PFLAB1-LARGE-PLATE6B.AB1 Blood stage Plasmodi... 38 0.71 3 (AF362369) Dictyostelium discoideum histidine kinase DhkG (d... 38 0.75 3 (EH011577) USDA-FP_184563 Lysiphlebus testaceipes adult whol... 38 0.77 2 (FE243229) CAPG7545.fwd CAPG Naegleria gruberi amoeba stage ... 34 0.77 3 (BG936921) jh_30301.z1 Penaeus chinensis' cephalothorax cDNA... 38 0.83 2 (AE014844) Plasmodium falciparum 3D7 chromosome 12, section ... 38 0.84 12 (AC206146) Saccoglossus kowalevskii clone CUGI_SK_BA 001A8, ... 38 0.84 4 (DY660416) SA_MF_06_E08 SA_MF Senecio aethnensis cDNA 5', mR... 48 0.95 1 (DY658851) SV_CP_06_A09 SV_CP Senecio vulgaris subsp. vulgar... 48 0.95 1 (CT901618) Phaeodactylum tricornutum 5-PRIME EST from clone ... 48 0.95 1 (FG331735) gmnlla_0019g17.sp6 Gadus morhua larvae library Ga... 48 0.95 1 (EL505146) F05_1991_1.AB1 Blood stage Plasmodium falciparum ... 32 0.96 3 (FF288881) pgsP0022F18 Solea senegalensis Mix of cDNA librar... 36 0.97 2 (AC109471) Homo sapiens chromosome 5 clone RP11-395P13, comp... 40 1.00 4 (EH014545) USDA-FP_187235 Lysiphlebus testaceipes adult whol... 38 1.0 2 (ES599305) BPE00000374 Buddenbrockia plumatellae SMART cDNA ... 38 1.1 2 (ED093004) AUAC-aah30c01.g1 Ascaris suum whole genome shotgu... 38 1.2 2 (ED303198) AUAC-aap18d10.b1 Ascaris suum whole genome shotgu... 38 1.2 2 (ED284499) AUAC-aap22e08.g1 Ascaris suum whole genome shotgu... 38 1.3 2 (FE043881) HA_MX2_72b08_SP6 Lobster Multiple Tissues, Normal... 40 1.3 2 (AC116960) Dictyostelium discoideum chromosome 2 map complem... 38 1.3 4 (AF063866) Melanoplus sanguinipes entomopoxvirus, complete g... 34 1.3 11 (AC116977) Dictyostelium discoideum chromosome 2 map 5515173... 42 1.3 2 (CR382401) Plasmodium falciparum chromosome 6, complete sequ... 38 1.4 5 (AE014830) Plasmodium falciparum 3D7 chromosome 10 section 2... 38 1.6 10 (AE001370) Plasmodium falciparum 3D7 chromosome 2 section 7 ... 38 1.6 3 (AC094242) Rattus norvegicus clone CH230-3F19, *** SEQUENCIN... 38 1.8 6 (CT025861) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 38 1.8 5 (AC201348) Strongylocentrotus purpuratus clone R3-17A16, WOR... 40 1.9 5 (EL501158) 060_PFLAB1-S-PLATE6B.AB1 Blood stage Plasmodium f... 32 2.1 3 (DQ342053) Dictyostelium discoideum STIP mRNA, complete cds. 38 2.1 3 (EL504051) B05_2638_1.AB1 Blood stage Plasmodium falciparum ... 36 2.1 3 (AE014842) Plasmodium falciparum 3D7 chromosome 11 section 7... 38 2.2 11 (AF362371) Dictyostelium discoideum histidine kinase DhkI (d... 38 2.3 3 (AC117073) Dictyostelium discoideum chromosome 2 map 6045872... 38 2.4 5 (AC006281) Plasmodium falciparum chromosome 12 clone PFYACB8... 38 2.4 7 (CV696607) SJS_026_43.T3 SJS Schistosoma japonicum cDNA, mRN... 32 2.5 2 (CT635233) Danio rerio EST, clone ZF_mu_104k12 3'. 42 2.5 2 (AE014837) Plasmodium falciparum 3D7 chromosome 11 section 2... 44 2.6 7 (EL927083) NY4Tr1_5_C11.g1_A039 NY4 trophonts (NY4Tr1) Ichth... 40 2.6 2 (AY254473) Dictyostelium discoideum nucleotide exchange fact... 38 2.7 3 (EG325133) EST_1074 Caste=Queen, Stage=Adult Vespula squamos... 28 2.7 4 (ER452122) 1092963853906 Global-Ocean-Sampling_GS-35-01-01-1... 42 2.8 2 (L18785) Plasmodium falciparum DNA polymerase alpha gene, co... 36 2.8 3 (AU088436) Plasmodium falciparum 3D7 cDNA clone from Sugano ... 38 2.8 2 (CR812467) Zebrafish DNA sequence *** SEQUENCING CANCELLED *... 38 2.8 7 (AC115592) Dictyostelium discoideum chromosome 2 map 1-12595... 38 2.9 3 (AC174103) Strongylocentrotus purpuratus clone R3-1031I12, W... 36 3.1 6 (AL929354) Plasmodium falciparum strain 3D7, chromosome 5, s... 38 3.1 7 (AL008970) Plasmodium falciparum MAL3P4. 36 3.2 6 (FE230868) CAPG10027.fwd CAPG Naegleria gruberi amoeba stage... 38 3.4 2 (DC226458) Plasmodium berghei strain ANKA cDNA clone:SG00587... 42 3.5 2 (DC208860) Plasmodium berghei strain ANKA cDNA clone:MG00921... 42 3.6 2 (AC005504) Plasmodium falciparum chromosome 12, *** SEQUENCI... 30 3.6 9 (CT509124) A BAC library has been constructed from cultivar ... 38 3.7 3 (BC125750) Xenopus tropicalis cDNA clone IMAGE:7683058. 46 3.7 1 (AC149162) Xenopus (Silurana) tropicalis clone ISB-362P17, c... 46 3.7 1 (CT030654) Mouse DNA sequence from clone RP23-332G16 on chro... 46 3.7 1 (CS601773) Sequence 759 from Patent WO2007039234. 46 3.7 1 (AL121957) Human DNA sequence from clone RP1-67A8 on chromos... 46 3.7 1 (ER569738) 1093015787223 Global-Ocean-Sampling_GS-36-01-01-2... 46 3.7 1 (EJ867833) 1093018291611 Global-Ocean-Sampling_GS-30-02-01-1... 46 3.7 1 (EJ863957) 1093018242054 Global-Ocean-Sampling_GS-30-02-01-1... 46 3.7 1 (EJ219465) 1092351191688 Global-Ocean-Sampling_GS-27-01-01-1... 46 3.7 1 (EJ135128) 1092343594392 Global-Ocean-Sampling_GS-27-01-01-1... 46 3.7 1 (EL352962) CCEL9592.b1_P22.ab1 CCE(LMS) endive Cichorium end... 46 3.7 1 (CX903136) JGI_CAAM14114.fwd NIH_XGC_tropTe3 Xenopus (Silura... 46 3.7 1 (CX890183) JGI_CAAM3042.fwd NIH_XGC_tropTe3 Xenopus (Siluran... 46 3.7 1 (CX360565) JGI_XZT1388.rev NIH_XGC_tropTad5 Xenopus (Siluran... 46 3.7 1 (CU418341) Pleurobrachia pileus 5-PRIME EST from clone SQ0AA... 46 3.7 1 (CT847708) Oryza sativa Indica Group EST sequence:OSIGCRN104... 46 3.7 1 (CP000903) Bacillus weihenstephanensis KBAB4, complete genome. 46 3.7 1 (CP000560) Bacillus amyloliquefaciens FZB42, complete genome. 46 3.7 1 (ED160091) AUAC-aam96c01.g1 Ascaris suum whole genome shotgu... 42 3.8 2 (EY361097) CAWZ7535.rev CAWZ Helobdella robusta Primary Late... 38 3.9 2 (EL502119) A11_PFLAB1-M-PLATE20BR.AB1 Blood stage Plasmodium... 38 3.9 2 (AQ647589) RPCI93-DpnII-29N12.TV RPCI93-DpnII Trypanosoma br... 40 4.0 2 (AC182060) Bos taurus clone CH240-481E7, WORKING DRAFT SEQUE... 38 4.1 4 (AC117176) Dictyostelium discoideum chromosome 2 map 5018074... 38 4.1 4 (ER462033) 1092963899423 Global-Ocean-Sampling_GS-35-01-01-1... 42 4.2 2 (CT613879) Danio rerio EST, clone ZF_mu_37e12 5'. 38 4.2 2 (AC176252) Strongylocentrotus purpuratus clone R3-3060I22, W... 34 4.4 6 (EC853066) HDE00004193 Hyperamoeba dachnaya Non-normalized (... 36 4.4 2 (ED427314) AUAC-aaf92b03.b1 Ascaris suum whole genome shotgu... 42 4.5 2 (DY885613) CeleSEQ925 Cunninghamella elegans pBluescript (Ec... 40 4.8 2 (AM426584) Vitis vinifera contig VV78X188817.7, whole genome... 40 4.8 2 (EJ134612) 1092343590548 Global-Ocean-Sampling_GS-27-01-01-1... 40 4.8 2 (ER421175) 1092963704869 Global-Ocean-Sampling_GS-35-01-01-1... 42 4.9 2 (AU073824) Dictyostelium discoideum slug cDNA, clone SSI452. 38 5.1 2 (AF362370) Dictyostelium discoideum histidine kinase DhkH (d... 38 5.1 2 (AY484462) Dictyostelium discoideum kinesin family member 8 ... 36 5.2 4 (BI815591) PfESToaa30d07.y1 Plasmodium falciparum 3D7 asexua... 34 5.2 3 (AC117081) Dictyostelium discoideum chromosome 2 map 5862124... 38 5.4 3 (EK174899) 1095458093499 Global-Ocean-Sampling_GS-31-01-01-1... 40 5.4 2 (CE535127) tigr-gss-dog-17000365910601 Dog Library Canis lup... 38 5.6 3 (CC633024) OGQAP53TV ZM_0.7_1.5_KB Zea mays genomic clone ZM... 30 5.7 4 (AC180295) Strongylocentrotus purpuratus clone R3-3119I17, W... 38 6.0 6 (EL499141) PFLAB1-S_F3_-P12A_A05_01.AB1 Blood stage Plasmodi... 34 6.1 2 (C91319) Dictyostelium discoideum slug cDNA, clone SSK294. 38 6.2 2 (CS468878) Sequence 69 from Patent EP1748080. 34 6.8 2 (CS468877) Sequence 68 from Patent EP1748080. 34 6.8 2 (CS419355) Sequence 69 from Patent WO2006094836. 34 6.8 2 (CS419354) Sequence 68 from Patent WO2006094836. 34 6.8 2 (AC216416) Populus trichocarpa clone POP048-M18, complete se... 32 6.9 2 (AC018615) Homo sapiens chromosome 2 clone RP11-129K3 map 2,... 34 7.0 2 (AC117080) Dictyostelium discoideum chromosome 2 map complem... 38 7.0 4 (AC007279) Homo sapiens BAC clone RP11-309N8 from 2, complet... 34 7.0 2 (AC181675) Strongylocentrotus purpuratus clone R3-3020A17, W... 34 7.1 2 (AC176589) Strongylocentrotus purpuratus clone R3-3077K21, W... 36 7.2 6 (DW282483) UI-S-HH0-adj-j-11-0-UI.s1 UI-S-HH0 Euprymna scolo... 30 7.2 4 (BJ345369) Dictyostelium discoideum cDNA clone:dda23a16, 3' ... 38 7.5 2 (FM992695) Candida dubliniensis CD36 chromosome R, complete ... 40 7.5 7 (CE612500) tigr-gss-dog-17000313546794 Dog Library Canis lup... 38 7.5 3 (AC179740) Strongylocentrotus purpuratus clone R3-1018H24, W... 44 7.6 8 (AL929356) Plasmodium falciparum strain 3D7, chromosome 9; s... 34 7.7 8 (AC131247) Strongylocentrotus purpuratus clone Sp114N15, ***... 40 7.7 5 (AF482389) Dictyostelium discoideum ABC transporter AbcG10 (... 34 7.9 3 (AU062021) Dictyostelium discoideum slug cDNA, clone SLH238. 36 8.0 2 (AC115612) Dictyostelium discoideum chromosome 2 map 6245135... 38 8.1 3 (CE771171) tigr-gss-dog-17000371059942 Dog Library Canis lup... 38 8.2 3 (DW176941) m3k05up.r1 Fiddler crab 4 day blastema cDNA libra... 40 8.2 2 (AC115599) Dictyostelium discoideum chromosome 2 map 4229098... 38 8.2 2 (CE621296) tigr-gss-dog-17000313631654 Dog Library Canis lup... 38 8.3 3 (CE559738) tigr-gss-dog-17000312682708 Dog Library Canis lup... 38 8.4 3 (CT997812) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 38 8.4 2 (ED293824) AUAC-aaa52h05.g1 Ascaris suum whole genome shotgu... 38 8.5 2 (AE014840) Plasmodium falciparum 3D7 chromosome 11 section 5... 38 8.6 9 (AE014839) Plasmodium falciparum 3D7 chromosome 11 section 4... 36 8.6 9 (AE014849) Plasmodium falciparum 3D7 chromosome 12, section ... 38 8.6 9 (AC157604) Ornithorhynchus anatinus chromosome UNK clone OAB... 40 8.9 2 (U42597) Dictyostelium discoideum histidine kinase A (dhkA) ... 38 8.9 3 (EA356980) Sequence 29 from patent US 7288385. 38 9.0 3 (EA356961) Sequence 9 from patent US 7288385. 38 9.0 3 (U58726) Caenorhabditis elegans cosmid T01C8, complete seque... 38 9.0 2 (AC213160) Populus trichocarpa clone POP105-D13, complete se... 32 9.3 7 (FE114372) LV_HC_RA060A08f Litopenaeus vannamei hemocyte cDN... 32 9.4 2 (FE114371) LV_HC_RA060O06r Litopenaeus vannamei hemocyte cDN... 32 9.4 2 (AL929359) Plasmodium falciparum strain 3D7, chromosome 9; s... 34 9.4 10 (FG811717) UCRVU04_CCNI12254_g1 Cowpea 524B Mixed Tissue and... 36 9.5 2 (FG811716) UCRVU04_CCNI12254_b1 Cowpea 524B Mixed Tissue and... 36 9.5 2 (FE098420) LV_HC_RA016G01r Litopenaeus vannamei hemocyte cDN... 38 9.5 3 (DE230003) Trifolium pratense DNA, clone:RCG23270. 38 9.6 2 (AC216684) Populus trichocarpa clone POP030-A02, complete se... 36 9.6 7 (AC181614) Strongylocentrotus purpuratus clone R3-1106O17, W... 34 9.7 5
>(BJ371869) Dictyostelium discoideum cDNA clone:ddc10g01, 3' end, single read. Length = 599
Score = 392 bits (198), Expect(3) = 0.0 Identities = 198/198 (100%) Strand = Plus / Minus
Query: 857 agtagttcatttgattataataatagtggtggtaatagtggaaattttatagacgattca 916 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 210 agtagttcatttgattataataatagtggtggtaatagtggaaattttatagacgattca 151
Query: 917 gtttatgaaattatgacattaacaggtgaaacgagtgtaaaaaatataaaagaagcatta 976 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 150 gtttatgaaattatgacattaacaggtgaaacgagtgtaaaaaatataaaagaagcatta 91
Query: 977 atcgattgtaattataatatagaagcagctgttgaatatttacttgctttatcattaagt 1036 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 90 atcgattgtaattataatatagaagcagctgttgaatatttacttgctttatcattaagt 31
Query: 1037 aaagatgattcagttgtt 1054 |||||||||||||||||| Sbjct: 30 aaagatgattcagttgtt 13
Score = 309 bits (156), Expect(3) = 0.0 Identities = 156/156 (100%) Strand = Plus / Minus
Query: 468 ttgaatcattcgaagagtacattcaagagatgagagaagatgcaacatggggtggtcatg 527 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 599 ttgaatcattcgaagagtacattcaagagatgagagaagatgcaacatggggtggtcatg 540
Query: 528 ttgaaattcaagcagcatcattggcttacaatgtaaatattactatacatcaaatggacc 587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 539 ttgaaattcaagcagcatcattggcttacaatgtaaatattactatacatcaaatggacc 480
Query: 588 aaccaagatgggaaatcgtcaaccatttcccacctg 623 |||||||||||||||||||||||||||||||||||| Sbjct: 479 aaccaagatgggaaatcgtcaaccatttcccacctg 444
Score = 274 bits (138), Expect(3) = 0.0 Identities = 143/145 (98%) Strand = Plus / Minus
Query: 631 caaaactattcatttatcatatcataatgatgaacattataattctgtaagacctgcaaa 690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 436 caaaactattcatttatcatatcataatgatgaacattataattctgtaagacctgcaaa 377
Query: 691 tcaatcattatatccaacaaaatcaaccagttcttcaccagttccaaattttgataataa 750 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 376 tcaatcattatatccaacanaatcaaccagttcttcaccagttccaaattttgataaaaa 317
Query: 751 acaaacttttcaaccttcttcaaag 775 ||||||||||||||||||||||||| Sbjct: 316 acaaacttttcaaccttcttcaaag 292
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 102105510 Number of Hits to DB: 1,368,052,785 Number of extensions: 92584634 Number of successful extensions: 10986665 Number of sequences better than 10.0: 214 Length of query: 1434 Length of database: 101,790,757,118 Length adjustment: 24 Effective length of query: 1410 Effective length of database: 99,340,224,878 Effective search space: 140069717077980 Effective search space used: 140069717077980 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|
protein update |
2009. 7.21 |
Homology vs Protein |
|
PSORT |
|
VS (DIR, S) |
0 |
VH (FL, L) |
0 |
VF (FL, S) |
0 |
AH (FL, L) |
0 |
AF (FL, S) |
1 |
SL (DIR, L) |
0 |
SS (DIR, S) |
1 |
SH (FL, L) |
0 |
SF (FL, S) |
0 |
CH (FL, L) |
0 |
CF (FL, S) |
1 |
FCL (DIR, L) |
0 |
FC (DIR, S) |
0 |
FC-IC (SUB) |
0 |