NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U14588-1
Contig ID Contig-U14588-1
Contig update 2002.12.18
Contig sequence 
>Contig-U14588-1 (Contig-U14588-1Q) /CSM_Contig/Contig-U14588-1Q.Seq.d
CCTACTGGAAAAAAAAAANCCACTNGACTTTAAAAAATAAANGATTAAAT
AAATAANCTTATTTATTNAACTTTTTTACTNGATAACTTNACTTTTNACC
TTACTTTNACTTTACTTTNACTTTACTTNACTTTACTTTNACTTTNACTT
TNACTTTTTCACACNCAAAATCTTTTTTTTTTTANNNNNNNNN
Gap no gap
Contig length 193
Chromosome number (1..6, M) -
Chromosome length -
Start point -
End point -
Strand (PLUS/MINUS) -
Number of clones 1
Number of EST 1
Link to clone list U14588
List of clone(s) 

est1=SHF306F,1,184
Translated Amino Acid sequence 
ptgkkkxtxl*kixd*INXLIYXTFLLDNXTFXLTXTLLXLYXTLLXLXLXLFHTQNLFF
FXXX
Translated Amino Acid sequence (All Frames) 
Frame A:
ptgkkkxtxl*kixd*INXLIYXTFLLDNXTFXLTXTLLXLYXTLLXLXLXLFHTQNLFF
FXXX


Frame B:
llekkxpldfkk*xik*ixlfixlfyxitxlxtllxlyfxftxlyfxfxfxfftxkifff
lxxx


Frame C:
ywkkkxhxtlknkxlnk*xylxnfftx*lxfxpyfxftxtllxftxtxtxtfshxksfff
xxx
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U14588-1 (Contig-U14588-1Q)
/CSM_Contig/Contig-U14588-1Q.Seq.d
         (193 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U14588-1 (Contig-U14588-1Q) /CSM_Contig/Conti...    54  5e-08
Contig-U13760-1 (Contig-U13760-1Q) /CSM_Contig/Conti...    30  0.79
Contig-U11246-1 (Contig-U11246-1Q) /CSM_Contig/Conti...    30  0.79
Contig-U14276-1 (Contig-U14276-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U13841-1 (Contig-U13841-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U11921-1 (Contig-U11921-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U11515-1 (Contig-U11515-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U06738-1 (Contig-U06738-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U05408-1 (Contig-U05408-1Q) /CSM_Contig/Conti...    28  3.1
Contig-U04842-1 (Contig-U04842-1Q) /CSM_Contig/Conti...    28  3.1

>Contig-U14588-1 (Contig-U14588-1Q) /CSM_Contig/Contig-U14588-1Q.Seq.d
          Length = 193

 Score = 54.0 bits (27), Expect = 5e-08
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                           
Query: 20 ccactngactttaaaaaataaangattaaataa 52
          |||||||||||||||||||||||||||||||||
Sbjct: 20 ccactngactttaaaaaataaangattaaataa 52


>Contig-U13760-1 (Contig-U13760-1Q) /CSM_Contig/Contig-U13760-1Q.Seq.d
          Length = 1276

 Score = 30.2 bits (15), Expect = 0.79
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 27   actttaaaaaataaa 41
            |||||||||||||||
Sbjct: 1186 actttaaaaaataaa 1200


>Contig-U11246-1 (Contig-U11246-1Q) /CSM_Contig/Contig-U11246-1Q.Seq.d
          Length = 2635

 Score = 30.2 bits (15), Expect = 0.79
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                           
Query: 27   actttaaaaaataaa 41
            |||||||||||||||
Sbjct: 2611 actttaaaaaataaa 2625


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1469
Number of Sequences: 6905
Number of extensions: 1469
Number of successful extensions: 434
Number of sequences better than 10.0: 10
length of query: 193
length of database: 5,674,871
effective HSP length: 15
effective length of query: 178
effective length of database: 5,571,296
effective search space: 991690688
effective search space used: 991690688
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2008.12.26
Homology vs DNA 
Query= Contig-U14588-1 (Contig-U14588-1Q) /CSM_Contig/Contig-U14588-1Q.Seq.d
         (193 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(BJ424062) Dictyostelium discoideum cDNA clone:ddv51c12, 5' ...    62   7e-06  1
(BJ423212) Dictyostelium discoideum cDNA clone:ddv48n10, 5' ...    62   7e-06  1
(BJ397682) Dictyostelium discoideum cDNA clone:dds47o01, 5' ...    62   7e-06  1
(BJ397445) Dictyostelium discoideum cDNA clone:dds46g08, 5' ...    62   7e-06  1
(BJ397437) Dictyostelium discoideum cDNA clone:dds46e11, 5' ...    62   7e-06  1
(BJ394859) Dictyostelium discoideum cDNA clone:dds36c20, 5' ...    62   7e-06  1
(BJ394786) Dictyostelium discoideum cDNA clone:dds36p12, 5' ...    62   7e-06  1
(BJ394697) Dictyostelium discoideum cDNA clone:dds36m04, 5' ...    62   7e-06  1
(BJ394525) Dictyostelium discoideum cDNA clone:dds35c13, 5' ...    62   7e-06  1
(BJ394185) Dictyostelium discoideum cDNA clone:dds34l01, 5' ...    62   7e-06  1
(BJ393762) Dictyostelium discoideum cDNA clone:dds32d16, 5' ...    62   7e-06  1
(BJ393604) Dictyostelium discoideum cDNA clone:dds31n22, 5' ...    62   7e-06  1
(BJ392727) Dictyostelium discoideum cDNA clone:dds28p15, 5' ...    62   7e-06  1
(BJ391728) Dictyostelium discoideum cDNA clone:dds24p22, 5' ...    62   7e-06  1
(BJ368492) Dictyostelium discoideum cDNA clone:ddc46o21, 5' ...    62   7e-06  1
(BJ367159) Dictyostelium discoideum cDNA clone:ddc41h15, 5' ...    62   7e-06  1
(BJ365917) Dictyostelium discoideum cDNA clone:ddc37e06, 5' ...    62   7e-06  1
(BJ365487) Dictyostelium discoideum cDNA clone:ddc35e15, 5' ...    62   7e-06  1
(BJ336479) Dictyostelium discoideum cDNA clone:dda54f04, 5' ...    62   7e-06  1
(BJ334205) Dictyostelium discoideum cDNA clone:dda45c13, 5' ...    62   7e-06  1
(BJ333378) Dictyostelium discoideum cDNA clone:dda42c16, 5' ...    62   7e-06  1
(BJ332445) Dictyostelium discoideum cDNA clone:dda39j05, 5' ...    62   7e-06  1
(BJ330751) Dictyostelium discoideum cDNA clone:dda32k13, 5' ...    54   0.002  1
(BJ396747) Dictyostelium discoideum cDNA clone:dds43e20, 5' ...    38   0.33   2
(BJ396736) Dictyostelium discoideum cDNA clone:dds43b21, 5' ...    38   0.33   2
(BJ397048) Dictyostelium discoideum cDNA clone:dds44j20, 5' ...    38   0.33   2
(BJ392484) Dictyostelium discoideum cDNA clone:dds27g19, 5' ...    38   0.33   2
(CR376777) Zebrafish DNA sequence from clone CH211-1I11 in l...    46   0.43   1
(AC098615) Homo sapiens chromosome 3 clone RP11-268I20, comp...    46   0.43   1
(CU928051) Brassica rapa subsp. pekinensis clone KBrH059L03,...    46   0.43   1
(CR925750) Zebrafish DNA sequence from clone CH211-242F23 in...    44   1.7    1
(BX511036) Zebrafish DNA sequence from clone DKEY-279D7 in l...    44   1.7    1
(BV398081) S243P64RD5.T0 CaliforniaCoyote Canis latrans STS ...    44   1.7    1
(CU928415) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f...    44   1.7    1
(AC214313) Equus caballus clone CH241-385C2, WORKING DRAFT S...    44   1.7    1
(AC205435) Equus caballus clone CH241-333H4, WORKING DRAFT S...    44   1.7    1
(CU164316) Equus caballus GSS, BAC clone CH241-286J15, SP6 e...    44   1.7    1
(BX208348) Danio rerio genomic clone DKEY-222B16, genomic su...    44   1.7    1
(CT596443) Danio rerio EST, clone ZF_mu_81i02 3'.                  44   1.7    1
(BV344289) S230P6404FF2.T0 Rottweiler Canis familiaris STS g...    42   6.7    1
(AC158942) Mus musculus chromosome 5, clone RP23-240A11, com...    42   6.7    1
(AC138671) Mus musculus chromosome 5, clone RP23-443N7, comp...    42   6.7    1
(AC124506) Mus musculus BAC clone RP23-425E23 from chromosom...    42   6.7    1
(AC117640) Mus musculus chromosome 5, clone RP23-228I1, comp...    42   6.7    1
(AC016791) Mus musculus chromosome 19, clone RP23-187B17, co...    42   6.7    1
(BS000105) Pan troglodytes chromosome 22 clone:RP43-117B17, ...    42   6.7    1
(AM485757) Vitis vinifera contig VV78X268250.30, whole genom...    42   6.7    1
(AM474948) Vitis vinifera, whole genome shotgun sequence, co...    42   6.7    1
(AM449252) Vitis vinifera, whole genome shotgun sequence, co...    42   6.7    1
(AM439616) Vitis vinifera contig VV78X111396.7, whole genome...    42   6.7    1
(AM439334) Vitis vinifera contig VV78X080155.8, whole genome...    42   6.7    1
(AX345427) Sequence 498 from Patent WO0200928.                     42   6.7    1
(AC191166) Canis Familiaris chromosome 14, clone XX-126F24, ...    42   6.7    1
(CR382401) Plasmodium falciparum chromosome 6, complete sequ...    42   6.7    1
(AE014816) Plasmodium falciparum 3D7 chromosome 14 section 1...    42   6.7    1
(AP001694) Homo sapiens genomic DNA, chromosome 21q, section...    42   6.7    1
(AP000223) Homo sapiens genomic DNA, chromosome 21q21.2, LL5...    42   6.7    1
(AP000138) Homo sapiens genomic DNA, chromosome 21q21.2, LL5...    42   6.7    1
(AP000086) Homo sapiens genomic DNA of 21q22.1, APP related,...    42   6.7    1
(AC068616) Homo sapiens BAC clone RP11-580J2 from 2, complet...    42   6.7    1
(AC040914) Homo sapiens chromosome 8, clone RP11-343P9, comp...    42   6.7    1
(AC152639) Bos taurus clone CH240-16D3, WORKING DRAFT SEQUEN...    42   6.7    1
(AC122070) Rattus norvegicus clone CH230-182I8, *** SEQUENCI...    42   6.7    1
(AC113875) Rattus norvegicus clone CH230-294L8, WORKING DRAF...    42   6.7    1
(AC096419) Rattus norvegicus clone CH230-24D13, WORKING DRAF...    42   6.7    1
(CU633589) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f...    42   6.7    1
(AC094202) Rattus norvegicus clone CH230-3A10, *** SEQUENCIN...    42   6.7    1
(AC201459) Strongylocentrotus purpuratus clone R3-3039I09, W...    42   6.7    1
(AC180396) Strongylocentrotus purpuratus clone R3-3106N18, W...    42   6.7    1
(AC178720) Strongylocentrotus purpuratus clone R3-12N10, WOR...    42   6.7    1
(AC170355) Bos taurus clone CH240-226C2, WORKING DRAFT SEQUE...    42   6.7    1
(BH330115) CH230-46H3.TJ CHORI-230 Segment 1 Rattus norvegic...    42   6.7    1
(BH320646) CH230-79M19.TJ CHORI-230 Segment 1 Rattus norvegi...    42   6.7    1
(BH310374) CH230-129N24.TJ CHORI-230 Segment 1 Rattus norveg...    42   6.7    1
(FH886275) OSB_664003xc12f1.ab1 OSB_664 Nicotiana tabacum ge...    42   6.7    1
(AL349179) Tetraodon nigroviridis genome survey sequence T3 ...    42   6.7    1
(DH226805) Oryzias latipes Fosmid clone:GOLWFno558_a17, forw...    42   6.7    1
(CT501233) A BAC library has been constructed from cultivar ...    42   6.7    1
(CC322521) TAM32-13K20_EC1.1 TAM32 Gallus gallus genomic clo...    42   6.7    1
(AG078500) Pan troglodytes DNA, clone: PTB-073N06.R.               42   6.7    1
(EL505522) G10_1461_20.AB1 Blood stage Plasmodium falciparum...    42   6.7    1
(EL500376) 023_PFLAB1-S-PLATE7B.AB1 Blood stage Plasmodium f...    42   6.7    1
(CK409449) AUF_IfLvr_222_i15 Ictalurus furcatus liver cDNA l...    42   6.7    1

>(BJ424062) Dictyostelium discoideum cDNA clone:ddv51c12, 5' end,
          single read.
          Length = 174

 Score = 61.9 bits (31), Expect = 7e-06
 Identities = 35/37 (94%)
 Strand = Plus / Plus


Query: 20 ccactngactttaaaaaataaangattaaataaataa 56
          ||||| |||||||||||||||| ||||||||||||||
Sbjct: 10 ccacttgactttaaaaaataaaagattaaataaataa 46

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 79,172,202
Number of extensions: 10025435
Number of successful extensions: 1880681
Number of sequences better than 10.0: 83
Length of query: 193
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 171
Effective length of database: 93,199,600,587
Effective search space: 15937131700377
Effective search space used: 15937131700377
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)
protein update 2009. 7.12
Homology vs Protein 
Query= Contig-U14588-1 (Contig-U14588-1Q) /CSM_Contig/Contig-U14588-1Q.Seq.d
         (193 letters)

Database: nrp_B
           3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 80,124,014
Number of extensions: 741030
Number of successful extensions: 274
Number of sequences better than 10.0: 0
Number of HSP's gapped: 274
Number of HSP's successfully gapped: 0
Length of query: 64
Length of database: 1,051,180,864
Length adjustment: 36
Effective length of query: 28
Effective length of database: 934,664,740
Effective search space: 26170612720
Effective search space used: 26170612720
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)
PSORT 

 psg: 0.92  gvh: 0.65  alm: 17.64  top: 0.57  tms: -0.07  mit: 0.35  mip: 0.00
 nuc: 0.00  erl: 0.00  erm: 0.00  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 0.00  m3b: 1.00  m_ : 0.00 

	 44.0 %: cytoplasmic
	 28.0 %: mitochondrial
	 12.0 %: nuclear
	  8.0 %: cytoskeletal
	  8.0 %: plasma membrane

>> prediction for Contig-U14588-1 is cyt
VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 1
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0