NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U14550-1
Contig ID Contig-U14550-1
Contig update 2002.12.18
Contig sequence 
>Contig-U14550-1 (Contig-U14550-1Q) /CSM_Contig/Contig-U14550-1Q.Seq.d
ATTTTTATTTTTTTAATTTTCATTTGCAGCAAACACACAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANN
TTTTTNNNAAAAAAANNNNNNNNN
Gap no gap
Contig length 124
Chromosome number (1..6, M) -
Chromosome length -
Start point -
End point -
Strand (PLUS/MINUS) -
Number of clones 1
Number of EST 1
Link to clone list U14550
List of clone(s) 

est1=SHC119F,1,115
Translated Amino Acid sequence 
IFIFLIFICSKHTKKKKKKKKKKKKKKKKKKKXXFXKKXXX
Translated Amino Acid sequence (All Frames) 
Frame A:
IFIFLIFICSKHTKKKKKKKKKKKKKKKKKKKXXFXKKXXX


Frame B:
flff*fsfaantqkkkkkkkkkkkkkkkkkkkxfxxkkxxx


Frame C:
fyffnfhlqqthkkkkkkkkkkkkkkkkkkkkxfxxkxxx
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U14550-1 (Contig-U14550-1Q)
/CSM_Contig/Contig-U14550-1Q.Seq.d
         (124 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U14550-1 (Contig-U14550-1Q) /CSM_Contig/Conti...    76  9e-15
Contig-U11284-1 (Contig-U11284-1Q) /CSM_Contig/Conti...    42  1e-04
Contig-U11018-1 (Contig-U11018-1Q) /CSM_Contig/Conti...    42  1e-04
Contig-U13787-1 (Contig-U13787-1Q) /CSM_Contig/Conti...    40  5e-04
Contig-U11233-1 (Contig-U11233-1Q) /CSM_Contig/Conti...    40  5e-04
Contig-U05739-1 (Contig-U05739-1Q) /CSM_Contig/Conti...    40  5e-04
Contig-U14000-1 (Contig-U14000-1Q) /CSM_Contig/Conti...    38  0.002
Contig-U12957-1 (Contig-U12957-1Q) /CSM_Contig/Conti...    38  0.002
Contig-U12809-1 (Contig-U12809-1Q) /CSM_Contig/Conti...    38  0.002
Contig-U11181-1 (Contig-U11181-1Q) /CSM_Contig/Conti...    38  0.002

>Contig-U14550-1 (Contig-U14550-1Q) /CSM_Contig/Contig-U14550-1Q.Seq.d
          Length = 124

 Score = 75.8 bits (38), Expect = 9e-15
 Identities = 38/38 (100%)
 Strand = Plus / Plus

                                                
Query: 1  atttttatttttttaattttcatttgcagcaaacacac 38
          ||||||||||||||||||||||||||||||||||||||
Sbjct: 1  atttttatttttttaattttcatttgcagcaaacacac 38


>Contig-U11284-1 (Contig-U11284-1Q) /CSM_Contig/Contig-U11284-1Q.Seq.d
          Length = 988

 Score = 42.1 bits (21), Expect = 1e-04
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 1   atttttatttttttaattttcattt 25
           |||||||||||||| ||||||||||
Sbjct: 123 atttttattttttttattttcattt 147


 Score = 26.3 bits (13), Expect = 7.6
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                        
Query: 2   tttttattttttt 14
           |||||||||||||
Sbjct: 158 tttttattttttt 170


 Score = 26.3 bits (13), Expect = 7.6
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                        
Query: 2   tttttattttttt 14
           |||||||||||||
Sbjct: 168 tttttattttttt 180


 Score = 26.3 bits (13), Expect = 7.6
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                        
Query: 1   atttttatttttt 13
           |||||||||||||
Sbjct: 150 atttttatttttt 162


>Contig-U11018-1 (Contig-U11018-1Q) /CSM_Contig/Contig-U11018-1Q.Seq.d
          Length = 1393

 Score = 42.1 bits (21), Expect = 1e-04
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 1   atttttatttttttaattttcattt 25
           |||||||||||||||||||| ||||
Sbjct: 172 atttttatttttttaatttttattt 196


 Score = 28.2 bits (14), Expect = 1.9
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                         
Query: 1   atttttattttttt 14
           ||||||||||||||
Sbjct: 187 atttttattttttt 200


 Score = 26.3 bits (13), Expect = 7.6
 Identities = 13/13 (100%)
 Strand = Plus / Minus

                        
Query: 2   tttttattttttt 14
           |||||||||||||
Sbjct: 385 tttttattttttt 373


 Score = 26.3 bits (13), Expect = 7.6
 Identities = 13/13 (100%)
 Strand = Plus / Plus

                        
Query: 2   tttttattttttt 14
           |||||||||||||
Sbjct: 103 tttttattttttt 115


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8393
Number of Sequences: 6905
Number of extensions: 8393
Number of successful extensions: 5290
Number of sequences better than 10.0: 1828
length of query: 124
length of database: 5,674,871
effective HSP length: 14
effective length of query: 110
effective length of database: 5,578,201
effective search space: 613602110
effective search space used: 613602110
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)
dna update 2008.12.25
Homology vs DNA 
Query= Contig-U14550-1 (Contig-U14550-1Q) /CSM_Contig/Contig-U14550-1Q.Seq.d
         (124 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 15,495,361
Number of extensions: 935083
Number of successful extensions: 225654
Number of sequences better than 10.0: 0
Length of query: 124
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 102
Effective length of database: 93,199,600,587
Effective search space: 9506359259874
Effective search space used: 9506359259874
X1: 11 (21.8 bits)
S2: 20 (40.1 bits)
protein update 2009. 7.11
Homology vs Protein 
Query= Contig-U14550-1 (Contig-U14550-1Q) /CSM_Contig/Contig-U14550-1Q.Seq.d
         (124 letters)

Database: nrp_B
           3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 52,498,659
Number of extensions: 541094
Number of successful extensions: 69
Number of sequences better than 10.0: 0
Number of HSP's gapped: 69
Number of HSP's successfully gapped: 0
Length of query: 41
Length of database: 1,051,180,864
Length adjustment: 15
Effective length of query: 26
Effective length of database: 1,002,632,479
Effective search space: 26068444454
Effective search space used: 26068444454
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 24 (13.9 bits)
PSORT 

 psg: 0.19  gvh: 0.43  alm: 0.52  top: 0.53  tms: 0.00  mit: 0.35  mip: 0.00
 nuc: 1.60  erl: 0.00  erm: 0.40  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 0.00  m3b: 0.00  m_ : 1.00 

	 76.0 %: nuclear
	 12.0 %: cytoplasmic
	  8.0 %: mitochondrial
	  4.0 %: cytoskeletal

>> prediction for Contig-U14550-1 is nuc
VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 1
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0