Contig-U14528-1
Contig ID Contig-U14528-1
Contig update 2002.12.18
Contig sequence
>Contig-U14528-1 (Contig-U14528-1Q) /CSM_Contig/Contig-U14528-1Q.Seq.d
GGAATAATAATAAAAATAGTAATAATAGTAAAATAATAGTAAAATAATAG
TGATAAATTATAAAATAAATTTAATTTTTATTTTAAAATTAATAGAGAAA
AAAAAAANNNNNNNNN

Gap no gap
Contig length 116
Chromosome number (1..6, M) 3
Chromosome length 6358359
Start point 1012928
End point 1013034
Strand (PLUS/MINUS) PLUS
Number of clones 1
Number of EST 1
Link to clone list U14528
List of clone(s)

est1=SHA111F,1,107
Translated Amino Acid sequence
e***k*****NNSKIIVINYKINLIFILKLIEKKKXXX


Translated Amino Acid sequence (All Frames)
Frame A:
giiikiviivk***nnsdkl*nkfnfyfkinrekkxxx


Frame B:
e***k*****NNSKIIVINYKINLIFILKLIEKKKXXX


Frame C:
nnnknsnnskiivk****iik*i*flf*n**rkkkxxx


own update ----------
Homology vs CSM-cDNA -
dna update 2008.12.24
Homology vs DNA
Query= Contig-U14528-1 (Contig-U14528-1Q) /CSM_Contig/Contig-U14528-1Q.Seq.d
(116 letters)

Database: ddbj_A
92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

***** No hits found ******

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 0
Number of sequences better than 10.0: 0
Length of query: 116
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 94
Effective length of database: 93,199,600,587
Effective search space: 8760762455178
Effective search space used: 8760762455178
X1: 11 (21.8 bits)
S2: 20 (40.1 bits)

protein update 2009. 7.11
Homology vs Protein
Query= Contig-U14528-1 (Contig-U14528-1Q) /CSM_Contig/Contig-U14528-1Q.Seq.d
(116 letters)

Database: nrp_B
3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

***** No hits found ******

Lambda K H
0.318 0.134 0.401

Gapped
Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 31,683,438
Number of extensions: 799927
Number of successful extensions: 129
Number of sequences better than 10.0: 0
Number of HSP's gapped: 129
Number of HSP's successfully gapped: 0
Length of query: 38
Length of database: 1,051,180,864
Length adjustment: 12
Effective length of query: 26
Effective length of database: 1,012,342,156
Effective search space: 26320896056
Effective search space used: 26320896056
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 24 (13.9 bits)

PSORT

psg: 0.81 gvh: 0.27 alm: 0.29 top: 0.53 tms: 0.07 mit: 0.25 mip: 0.00
nuc: 0.12 erl: 0.00 erm: 0.40 pox: 0.00 px2: 0.00 vac: 0.00 rnp: 0.00
act: 0.00 caa: 0.00 yqr: 1.00 tyr: 0.00 leu: 0.00 gpi: 0.00 myr: 0.00
dna: 0.00 rib: 0.00 bac: 0.00 m1a: 0.00 m1b: 0.00 m2 : 1.00 mNt: 0.00
m3a: 0.00 m3b: 0.00 m_ : 0.00

24.0 %: mitochondrial
24.0 %: nuclear
24.0 %: endoplasmic reticulum
20.0 %: cytoplasmic
4.0 %: plasma membrane
4.0 %: vesicles of secretory system

>> prediction for Contig-U14528-1 is mit

VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 1
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0