NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U13270-1
Contig ID Contig-U13270-1
Contig update 2002.12.18
Contig sequence 
>Contig-U13270-1 (Contig-U13270-1Q) /CSM_Contig/Contig-U13270-1Q.Seq.d
AAAAAAAAAAAAAATAAAATATATTTGTATACTAATTTTTTTTATTATCA
TTTTATATTTTACTTAATATTTATTTAATATATAAAAACTTTATTTTTCA
AATCATATATCACATTATTATTATAATAATATAATAATAATAATAATTAA
TAATTAATAAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAACCCNAAAAAAAAA
Gap no gap
Contig length 223
Chromosome number (1..6, M) 1
Chromosome length 4919822
Start point 634553
End point 634331
Strand (PLUS/MINUS) MINUS
Number of clones 14
Number of EST 16
Link to clone list U13270
List of clone(s) 

est1=SHD380Z,-46,143
est2=SHB784F,12,223
est3=CHK423F,18,169
est4=SHB448F,19,223
est5=CHG351F,21,169
est6=CHG351Z,21,122
est7=SHI634F,21,168
est8=CHI323F,23,169
est9=CHI323Z,23,134
est10=AHK705F,29,168
est11=SHE116F,44,168
est12=SHG571F,46,168
est13=SHG656F,55,168
est14=AHQ880F,62,168
est15=SHF518F,62,168
est16=SHG322F,63,168
Translated Amino Acid sequence 
kkkk*nifvy*FFLLSFYILLNIYLIYKNFIFQIIYHIIIIII*****liinkkkkkgkk
kkkkkkkkktxkk
Translated Amino Acid sequence (All Frames) 
Frame A:
kkkknkiylytnffyyhfifylifi*yiktlffksyitlll**ynnnnn**likkkkkek
kkkkkkkkkkpxkk


Frame B:
kkkkikyiciliffiiilyft*ylfni*klyfsnhishyyynniiiiiinn**kkkkrkk
kkkkkkkkknpkkk


Frame C:
kkkk*nifvy*FFLLSFYILLNIYLIYKNFIFQIIYHIIIIII*****liinkkkkkgkk
kkkkkkkkktxkk
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U13270-1 (Contig-U13270-1Q)
/CSM_Contig/Contig-U13270-1Q.Seq.d
         (223 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U13270-1 (Contig-U13270-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U12060-1 (Contig-U12060-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U09486-1 (Contig-U09486-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U09376-1 (Contig-U09376-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U06714-1 (Contig-U06714-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U06665-1 (Contig-U06665-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U03321-1 (Contig-U03321-1Q) /CSM_Contig/Conti...    36  0.015
Contig-U11701-1 (Contig-U11701-1Q) /CSM_Contig/Conti...    34  0.059
Contig-U11316-1 (Contig-U11316-1Q) /CSM_Contig/Conti...    34  0.059
Contig-U11207-1 (Contig-U11207-1Q) /CSM_Contig/Conti...    34  0.059

>Contig-U13270-1 (Contig-U13270-1Q) /CSM_Contig/Contig-U13270-1Q.Seq.d
          Length = 223

 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 141 taataattaataattaat 158
           ||||||||||||||||||
Sbjct: 141 taataattaataattaat 158


>Contig-U12060-1 (Contig-U12060-1Q) /CSM_Contig/Contig-U12060-1Q.Seq.d
          Length = 1537

 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            ||||||||||||||||||
Sbjct: 1414 taataattaataattaat 1431


 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            ||||||||||||||||||
Sbjct: 1048 taataattaataattaat 1065


 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            ||||||||||||||||||
Sbjct: 1062 taataattaataattaat 1079


 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            ||||||||||||||||||
Sbjct: 1055 taataattaataattaat 1072


 Score = 34.2 bits (17), Expect = 0.059
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 142  aataattaataattaat 158
            |||||||||||||||||
Sbjct: 1042 aataattaataattaat 1058


 Score = 30.2 bits (15), Expect = 0.92
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            ||||||||||| ||||||
Sbjct: 1421 taataattaatnattaat 1438


 Score = 30.2 bits (15), Expect = 0.92
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                              
Query: 141  taataattaataattaat 158
            |||| |||||||||||||
Sbjct: 1428 taatnattaataattaat 1445


 Score = 28.2 bits (14), Expect = 3.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 141  taataattaataat 154
            ||||||||||||||
Sbjct: 1457 taataattaataat 1470


 Score = 28.2 bits (14), Expect = 3.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 141  taataattaataat 154
            ||||||||||||||
Sbjct: 1091 taataattaataat 1104


 Score = 28.2 bits (14), Expect = 3.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 141  taataattaataat 154
            ||||||||||||||
Sbjct: 1435 taataattaataat 1448


 Score = 28.2 bits (14), Expect = 3.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                          
Query: 141  taataattaataat 154
            ||||||||||||||
Sbjct: 1069 taataattaataat 1082


>Contig-U09486-1 (Contig-U09486-1Q) /CSM_Contig/Contig-U09486-1Q.Seq.d
          Length = 638

 Score = 36.2 bits (18), Expect = 0.015
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 141 taataattaataattaat 158
           ||||||||||||||||||
Sbjct: 130 taataattaataattaat 147


 Score = 34.2 bits (17), Expect = 0.059
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 141 taataattaataattaa 157
           |||||||||||||||||
Sbjct: 137 taataattaataattaa 153


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 967
Number of Sequences: 6905
Number of extensions: 967
Number of successful extensions: 393
Number of sequences better than 10.0: 66
length of query: 223
length of database: 5,674,871
effective HSP length: 15
effective length of query: 208
effective length of database: 5,571,296
effective search space: 1158829568
effective search space used: 1158829568
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2008.12. 7
Homology vs DNA 
Query= Contig-U13270-1 (Contig-U13270-1Q) /CSM_Contig/Contig-U13270-1Q.Seq.d
         (223 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 0
Number of sequences better than 10.0: 0
Length of query: 223
Length of database: 95,242,211,685
Length adjustment: 23
Effective length of query: 200
Effective length of database: 93,106,754,628
Effective search space: 18621350925600
Effective search space used: 18621350925600
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)
protein update 2009. 7. 6
Homology vs Protein 
Query= Contig-U13270-1 (Contig-U13270-1Q) /CSM_Contig/Contig-U13270-1Q.Seq.d
         (223 letters)

Database: nrp_B
           3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 68,024,655
Number of extensions: 271320
Number of successful extensions: 252
Number of sequences better than 10.0: 0
Number of HSP's gapped: 252
Number of HSP's successfully gapped: 0
Length of query: 74
Length of database: 1,051,180,864
Length adjustment: 45
Effective length of query: 29
Effective length of database: 905,535,709
Effective search space: 26260535561
Effective search space used: 26260535561
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 27 (15.0 bits)
PSORT 

 psg: 0.96  gvh: 0.44  alm: 0.33  top: 0.57  tms: 0.00  mit: 0.33  mip: 0.00
 nuc: 0.00  erl: 0.00  erm: 0.00  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 0.00  m3b: 0.00  m_ : 1.00 

	 40.0 %: cytoplasmic
	 24.0 %: nuclear
	 16.0 %: mitochondrial
	  4.0 %: extracellular, including cell wall
	  4.0 %: cytoskeletal
	  4.0 %: endoplasmic reticulum
	  4.0 %: plasma membrane
	  4.0 %: vesicles of secretory system

>> prediction for Contig-U13270-1 is cyt
VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 2
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 9
SF (FL, S) 0
CH (FL, L) 3
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0