Contig-U13035-1
Contig ID Contig-U13035-1
Contig update 2002.12.18
Contig sequence
>Contig-U13035-1 (Contig-U13035-1Q) /CSM_Contig/Contig-U13035-1Q.Seq.d
AATTTATTTTATCATTAATTATTTAGTTTGGGAAAAAAAGAAATAAATAC
TTAATCCTTGCTTGTAATAGATTCAAACTTTAAAATAATAAAAATAAATA
ATTAAAAATATTTTAAAAAAAATATAAAAGTATAAAATATAAAAAAAATA
TTTGGAATAGAAAAAAAAAA

Gap no gap
Contig length 170
Chromosome number (1..6, M) 6
Chromosome length 3595308
Start point 3021548
End point 3021379
Strand (PLUS/MINUS) MINUS
Number of clones 4
Number of EST 4
Link to clone list U13035
List of clone(s)

est1=CHR522F,1,170
est2=SHH603F,1,169
est3=SHL778F,1,169
est4=CHJ490F,6,170
Translated Amino Acid sequence
filslii*FGKKRNKYLILACNRFKL*nnknk*lkif*kkyksikykkniwnrkkk


Translated Amino Acid sequence (All Frames)
Frame A:
nlfyh*lfslgkkeint*sllvidsnfkiikinn*kyfkknikv*nikkifgiekk


Frame B:
iyfiinylvwekkk*ilnpcl**iqtlk**k*iiknilkki*kyki*kkyle*kkk


Frame C:
filslii*FGKKRNKYLILACNRFKL*nnknk*lkif*kkyksikykkniwnrkkk


own update 2004. 6.10
Homology vs CSM-cDNA
Query= Contig-U13035-1 (Contig-U13035-1Q)
/CSM_Contig/Contig-U13035-1Q.Seq.d
(170 letters)

Database: CSM
6905 sequences; 5,674,871 total letters


Score E
Sequences producing significant alignments: (bits) Value

Contig-U13035-1 (Contig-U13035-1Q) /CSM_Contig/Conti... 64 5e-11
Contig-U01402-1 (Contig-U01402-1Q) /CSM_Contig/Conti... 34 0.044
Contig-U12070-1 (Contig-U12070-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U11429-1 (Contig-U11429-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U09569-1 (Contig-U09569-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U03115-1 (Contig-U03115-1Q) /CSM_Contig/Conti... 32 0.17
Contig-U14701-1 (Contig-U14701-1Q) /CSM_Contig/Conti... 30 0.69
Contig-U14694-1 (Contig-U14694-1Q) /CSM_Contig/Conti... 30 0.69
Contig-U14498-1 (Contig-U14498-1Q) /CSM_Contig/Conti... 30 0.69

>Contig-U13035-1 (Contig-U13035-1Q) /CSM_Contig/Contig-U13035-1Q.Seq.d
Length = 170

Score = 63.9 bits (32), Expect = 5e-11
Identities = 32/32 (100%)
Strand = Plus / Plus


Query: 1 aatttattttatcattaattatttagtttggg 32
||||||||||||||||||||||||||||||||
Sbjct: 1 aatttattttatcattaattatttagtttggg 32


>Contig-U01402-1 (Contig-U01402-1Q) /CSM_Contig/Contig-U01402-1Q.Seq.d
Length = 1322

Score = 34.2 bits (17), Expect = 0.044
Identities = 20/21 (95%)
Strand = Plus / Plus


Query: 4 ttattttatcattaattattt 24
||||||||| |||||||||||
Sbjct: 26 ttattttataattaattattt 46


>Contig-U12070-1 (Contig-U12070-1Q) /CSM_Contig/Contig-U12070-1Q.Seq.d
Length = 1331

Score = 32.2 bits (16), Expect = 0.17
Identities = 16/16 (100%)
Strand = Plus / Plus


Query: 9 ttatcattaattattt 24
||||||||||||||||
Sbjct: 1240 ttatcattaattattt 1255


Database: CSM
Posted date: Jun 9, 2004 7:35 PM
Number of letters in database: 5,674,871
Number of sequences in database: 6905

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1578
Number of Sequences: 6905
Number of extensions: 1578
Number of successful extensions: 475
Number of sequences better than 10.0: 57
length of query: 170
length of database: 5,674,871
effective HSP length: 15
effective length of query: 155
effective length of database: 5,571,296
effective search space: 863550880
effective search space used: 863550880
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2008.12. 5
Homology vs DNA
Query= Contig-U13035-1 (Contig-U13035-1Q) /CSM_Contig/Contig-U13035-1Q.Seq.d
(170 letters)

Database: ddbj_A
92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

Score E
Sequences producing significant alignments: (bits) Value N

(BJ397853) Dictyostelium discoideum cDNA clone:dds47l19, 5' ... 64 2e-06 1
(BJ371224) Dictyostelium discoideum cDNA clone:ddc57k05, 5' ... 64 2e-06 1
(BJ395483) Dictyostelium discoideum cDNA clone:dds39e02, 5' ... 56 4e-04 1
(BJ366940) Dictyostelium discoideum cDNA clone:ddc40d24, 5' ... 54 0.002 1
(U32466) Speyeria atlantis NADH dehydrogenase subunit 1 (ND1... 46 0.37 1
(AJ505593) Alcis repandata mitochondrion 16S rRNA gene (part... 46 0.37 1
(AJ438725) Alcis repandata mitochondrion nd1 gene (partial),... 46 0.37 1
(AJ416938) Alcis repandata mitochondrion nd1 gene (partial),... 46 0.37 1
(AE014838) Plasmodium falciparum 3D7 chromosome 11 section 3... 46 0.37 1
(AP010108) Lotus japonicus genomic DNA, clone: LjT36B17, TM0... 44 1.5 1
(AZ931217) 474.dhz63d07.s1 Saccharomyces unisporus NRRL Y-15... 44 1.5 1
(ER458902) 1092963880449 Global-Ocean-Sampling_GS-35-01-01-1... 44 1.5 1
(EK313599) 1095462405543 Global-Ocean-Sampling_GS-31-01-01-1... 44 1.5 1
(AM643026) Entamoeba dispar GSS, clone dispar9g05.q1k. 44 1.5 1
(DE915979) Macropus eugenii DNA, BAC clone: MEB1-101E04_R, 3... 44 1.5 1
(AG231925) Lotus japonicus DNA, clone:LjB22i20_r. 44 1.5 1
(DT614787) ACAH-aaa10b06.g1 Hydra_EST_UCI-10 Hydra magnipapi... 44 1.5 1
(DT611896) ACAG-aaa48f05.g1 Hydra_EST_UCI-9 Hydra magnipapil... 44 1.5 1
(DT605700) ACAH-aaa75d06.g1 Hydra_EST_UCI-10 Hydra magnipapi... 44 1.5 1
(DR435525) ACAB-aaa32c12.g1 Hydra UCI6- barcoded EST's Hydra... 44 1.5 1
(DN815451) ACAC-aab62k12.g1 Hydra EST UCI 7 Hydra magnipapil... 44 1.5 1
(CX830766) ACAC-aaa21g06.g1 Hydra EST UCI 7 Hydra magnipapil... 44 1.5 1
(EF040098) Synthetic construct Bacillus anthracis clone FLH2... 42 5.8 1
(AC155251) Mus musculus BAC clone RP24-201E19 from chromosom... 42 5.8 1
(AC110816) Mus musculus BAC clone RP23-20P15 from chromosome... 42 5.8 1
(AC200340) Pongo abelii BAC clone CH276-138E9 from chromosom... 42 5.8 1
(AC160940) Pan troglodytes BAC clone CH251-503N14 from chrom... 42 5.8 1
(AC156944) Pan troglodytes BAC clone CH251-396D8 from chromo... 42 5.8 1
(AC156806) Pan troglodytes BAC clone CH251-342H5 from chromo... 42 5.8 1
(AC091778) Papio anubis clone rp41-280n2, complete sequence. 42 5.8 1
(CS742027) Sequence 10023 from Patent WO2005083127. 42 5.8 1
(CQ519288) Sequence 51155 from Patent WO0160860. 42 5.8 1
(AR031798) Sequence 1 from patent US 5866412. 42 5.8 1
(AL445990) Human DNA sequence from clone RP11-103A6 on chrom... 42 5.8 1
(AF297093) Homo sapiens UGT1 gene locus, complete sequence. 42 5.8 1
(AC019072) Homo sapiens BAC clone RP11-289A15 from 2, comple... 42 5.8 1
(AC015819) Homo sapiens chromosome 18, clone RP11-405M12, co... 42 5.8 1
(AC106501) Rattus norvegicus clone CH230-215G2, *** SEQUENCI... 42 5.8 1
(AC106468) Rattus norvegicus clone CH230-212C19, WORKING DRA... 42 5.8 1
(CU633335) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 42 5.8 1
(AC217005) Pongo abelii chromosome 12 clone CH276-455A10, WO... 42 5.8 1
(AC194510) Colobus guereza clone CH272-417D13, WORKING DRAFT... 42 5.8 1
(AC189286) Solanum lycopersicum chromosome 5 clone C05HBa010... 42 5.8 1
(AC182647) Solanum lycopersicum chromosome 5 clone C05HBa000... 42 5.8 1
(AC171066) Macaca mulatta clone CH250-485P5, WORKING DRAFT S... 42 5.8 1
(AC015905) Homo sapiens clone RP11-44A10, WORKING DRAFT SEQU... 42 5.8 1
(ET695218) CHO_OF358xc03r1.ab1 CHO_OF Nicotiana tabacum geno... 42 5.8 1
(ET695153) CHO_OF358xc03f1.ab1 CHO_OF Nicotiana tabacum geno... 42 5.8 1
(EK121025) 1092963422600 Global-Ocean-Sampling_GS-31-01-01-1... 42 5.8 1
(ED713248) GM_WBb0061H09.r GM_WBb Glycine max genomic clone ... 42 5.8 1
(CR956763) Equus caballus GSS, BAC clone CH241-110I6, T7 end... 42 5.8 1
(B37050) HS-1042-B1-B12-MF.abi CIT Human Genomic Sperm Libra... 42 5.8 1
(BH949441) odi86c09.b1 B.oleracea002 Brassica oleracea genom... 42 5.8 1
(CX582746) TTE00022573 Amplicon Express - Conjugative Form T... 42 5.8 1
(CP000485) Bacillus thuringiensis str. Al Hakam, complete ge... 42 5.8 1
(AE017334) Bacillus anthracis str. 'Ames Ancestor', complete... 42 5.8 1
(AE017225) Bacillus anthracis str. Sterne, complete genome. 42 5.8 1
(AE016879) Bacillus anthracis str. Ames, complete genome. 42 5.8 1
(CU468818) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 30 9.8 2

>(BJ397853) Dictyostelium discoideum cDNA clone:dds47l19, 5' end,
single read.
Length = 169

Score = 63.9 bits (32), Expect = 2e-06
Identities = 32/32 (100%)
Strand = Plus / Plus


Query: 1 aatttattttatcattaattatttagtttggg 32
||||||||||||||||||||||||||||||||
Sbjct: 1 aatttattttatcattaattatttagtttggg 32

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 63,771,662
Number of extensions: 4668862
Number of successful extensions: 1318024
Number of sequences better than 10.0: 59
Length of query: 170
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 148
Effective length of database: 93,199,600,587
Effective search space: 13793540886876
Effective search space used: 13793540886876
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)

protein update 2009. 7. 5
Homology vs Protein
Query= Contig-U13035-1 (Contig-U13035-1Q) /CSM_Contig/Contig-U13035-1Q.Seq.d
(170 letters)

Database: nrp_B
3,236,559 sequences; 1,051,180,864 total letters

Searching..................................................done

***** No hits found ******

Lambda K H
0.318 0.134 0.401

Gapped
Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3236559
Number of Hits to DB: 105,086,438
Number of extensions: 594328
Number of successful extensions: 331
Number of sequences better than 10.0: 0
Number of HSP's gapped: 331
Number of HSP's successfully gapped: 0
Length of query: 56
Length of database: 1,051,180,864
Length adjustment: 29
Effective length of query: 27
Effective length of database: 957,320,653
Effective search space: 25847657631
Effective search space used: 25847657631
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)

PSORT -
VS (DIR, S) 0
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 2
SF (FL, S) 0
CH (FL, L) 2
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0