Contig-U11652-1 |
Contig ID |
Contig-U11652-1 |
Contig update |
2002.12.18 |
Contig sequence |
|
Gap |
gap included |
Contig length |
1213 |
Chromosome number (1..6, M) |
3 |
Chromosome length |
6358359 |
Start point |
3246603 |
End point |
3247610 |
Strand (PLUS/MINUS) |
PLUS |
Number of clones |
6 |
Number of EST |
7 |
Link to clone list |
U11652 |
List of clone(s) |
|
Translated Amino Acid sequence |
|
Translated Amino Acid sequence (All Frames) |
|
own update |
2004. 6.10 |
Homology vs CSM-cDNA |
|
dna update |
2008.11.25 |
Homology vs DNA |
Query= Contig-U11652-1 (Contig-U11652-1Q) /CSM_Contig/Contig-U11652-1Q.Seq.d (1223 letters)
Database: ddbj_A 92,845,959 sequences; 95,242,211,685 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AU060751) Dictyostelium discoideum slug cDNA, clone SLB353. 753 0.0 2 (BJ377714) Dictyostelium discoideum cDNA clone:ddc25e13, 3' ... 355 0.0 2 (AU033718) Dictyostelium discoideum slug cDNA, clone SLB353. 339 e-139 3 (AJ699380) Dictyostelium discoideum u2 snRNA, clone ddR-19. 408 e-109 1 (BJ363199) Dictyostelium discoideum cDNA clone:ddc25e13, 5' ... 408 e-109 1 (BJ363200) Dictyostelium discoideum cDNA clone:ddc25e14, 5' ... 402 e-107 1 (DQ012952) Dictyostelium discoideum U2C snRNA, partial seque... 355 3e-93 1 (AU267023) Dictyostelium discoideum vegetative cDNA clone:VS... 129 1e-35 2 (BJ399468) Dictyostelium discoideum cDNA clone:dds6k01, 3' e... 129 3e-25 1 (BJ371899) Dictyostelium discoideum cDNA clone:ddc10a10, 3' ... 125 4e-24 1 (DQ012953) Dictyostelium discoideum U2D snRNA, complete sequ... 52 2e-10 3 (AC115581) Dictyostelium discoideum chromosome 2 map complem... 52 7e-08 8 (DQ012955) Dictyostelium discoideum U2F snRNA, complete sequ... 52 2e-06 3 (BZ387550) EINCN20TF EI_10_12_KB Entamoeba invadens genomic ... 64 1e-05 1 (AZ679350) ENTMC32TF Entamoeba histolytica Sheared DNA Entam... 60 2e-04 1 (AZ668388) ENTMT49TF Entamoeba histolytica Sheared DNA Entam... 60 2e-04 1 (AM644803) Entamoeba moshkovskii FIC GSS, clone mosh016d08.p1k. 60 2e-04 1 (AM633230) Entamoeba dispar GSS, clone dispar99e05.q1k. 60 2e-04 1 (EU115964) Dictyostelium discoideum Ddi2645 RNA, complete se... 54 0.013 1 (EY479432) CBBP1027.fwd CBBP Hirudo medicinalis hermaphrodit... 54 0.013 1 (AJ438829) Plasmodium reichenowi partial eba-140 homologous ... 44 0.035 2 (BH156468) ENTRM59TR Entamoeba histolytica Sheared DNA Entam... 52 0.051 1 (AY572433) Plasmodium reichenowi erythrocyte invasion ligand... 44 0.077 2 (BQ596524) PfESToab18h10.y1 Plasmodium falciparum 3D7 asexua... 38 0.13 2 (Z50072) V.necatrix DNA for U2 snRNA gene. 50 0.20 1 (AY033090) Plasmodium falciparum Pfs38 gene, complete cds. 38 0.30 2 (AK222378) Ciona intestinalis cDNA, clone:ciem804c24, full i... 48 0.79 1 (DX755638) 2318921 VV03 Ustilago maydis genomic clone 100800... 48 0.79 1 (DX749914) 2513560 VV03 Ustilago maydis genomic clone 108138... 48 0.79 1 (DX697308) 2118672 VV03 Ustilago maydis genomic clone 896828... 48 0.79 1 (DX696223) 2212248 VV03 Ustilago maydis genomic clone 863033... 48 0.79 1 (DX676135) 2245188 VV03 Ustilago maydis genomic clone 883673... 48 0.79 1 (DX636193) 2106994 VV02 Ustilago maydis genomic clone 812537... 48 0.79 1 (EH028505) MMN_43_E01 Haploid cells grown in Minimal Media m... 48 0.79 1 (EH028097) MMN_38_H05 Haploid cells grown in Minimal Media m... 48 0.79 1 (AV436604) Porphyra yezoensis cDNA clone:PS005h12_r, 5' end. 48 0.79 1 (FK042477) XABT72051.b2 Gateway compatible cien cDNA library... 48 0.79 1 (AZ533598) ENTCV66TF Entamoeba histolytica Sheared DNA Entam... 46 0.95 2 (DT270320) JGI_CAAV3433.rev CAAV Pimephales promelas testis ... 36 1.5 3 (AC120489) Rattus norvegicus clone CH230-118C6, *** SEQUENCI... 40 1.8 6 (CT455073) Sus scrofa genomic clone CH242-455N24, genomic su... 42 3.1 2 (CR352298) Zebrafish DNA sequence from clone CH211-150E10 in... 46 3.1 1 (CR318652) Zebrafish DNA sequence from clone CH211-128O18 in... 46 3.1 1 (BX548023) Zebrafish DNA sequence from clone DKEY-265O13 in ... 46 3.1 1 (Y15811) Xanthophyllomyces dendrorhous idi gene. 46 3.1 1 (X71483) C.reinhardtii U2 snRNA. 46 3.1 1 (DQ235686) Xanthophyllomyces dendrorhous isopentenyl diphosp... 46 3.1 1 (AL590446) chromosome VI of strain GB-M1 of Encephalitozoon ... 46 3.1 1 (AF053589) Nosema locustae U2 snRNA gene, complete sequence. 46 3.1 1 (AC108605) Rattus norvegicus clone CH230-267P22, *** SEQUENC... 46 3.1 1 (AC103229) Rattus norvegicus clone CH230-217O18, WORKING DRA... 46 3.1 1 (BX908730) Zebrafish DNA sequence *** SEQUENCING CANCELLED *... 46 3.1 1 (AC188516) Sorex araneus clone SA_Ba-437F12, WORKING DRAFT S... 46 3.1 1 (AZ549008) ENTFK29TR Entamoeba histolytica Sheared DNA Entam... 46 3.1 1 (AZ544770) ENTFL48TF Entamoeba histolytica Sheared DNA Entam... 46 3.1 1 (ER468770) 1092963941522 Global-Ocean-Sampling_GS-35-01-01-1... 46 3.1 1 (ED231534) AUAC-aac53e10.g1 Ascaris suum whole genome shotgu... 46 3.1 1 (DU761966) ASNG3960.b2 HF200_10-06-02 uncultured marine micr... 46 3.1 1 (CT545860) A BAC library has been constructed from cultivar ... 46 3.1 1 (EG000200) EST72818 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (AV630147) Chlamydomonas reinhardtii cDNA clone:LCL074c03_r,... 46 3.1 1 (AV628511) Chlamydomonas reinhardtii cDNA clone:LCL043a08_r,... 46 3.1 1 (AV625999) Chlamydomonas reinhardtii cDNA clone:LC100h06_r, ... 46 3.1 1 (AV621816) Chlamydomonas reinhardtii cDNA clone:LC041c12_r, ... 46 3.1 1 (AV619633) Chlamydomonas reinhardtii cDNA clone:LC011a07_r, ... 46 3.1 1 (AV618976) Chlamydomonas reinhardtii cDNA clone:LC002b02_r, ... 46 3.1 1 (EB098643) EST61075 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (EB087203) EST49635 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW995750) EST48131 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW987329) EST39710 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW211062) EST27326 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW209158) EST25422 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW208464) EST24728 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW203417) EST19681 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW202972) EST19242 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DW188938) EST05208 Larval Stage 1 Aedes aegypti cDNA clone ... 46 3.1 1 (DV437691) NAEA355TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV436190) NADCI33TR Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV436189) NADCI33TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV424388) NADY582TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV408912) NADWP86TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV406017) NADWP86TR Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV402748) NADVK63TR Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV402746) NADVK63TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV402671) NADWY29TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV395509) NADEC80TR Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV395508) NADEC80TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV390753) NADBL28TF Aedes aegypti infected with Dengue viru... 46 3.1 1 (DV376464) NACNU79TO Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV376462) NACNU79TF Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV367301) NACBH39TR Aedes aegypti infected with Brugia Mala... 46 3.1 1 (DV367300) NACBH39TF Aedes aegypti infected with Brugia Mala... 46 3.1 1 (DV364875) NACA740TR Aedes aegypti infected with Brugia Mala... 46 3.1 1 (DV364874) NACA740TF Aedes aegypti infected with Brugia Mala... 46 3.1 1 (DV357299) NABZ403TF Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV350377) NABXV03TF Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV346964) NABWP29TF Aedes aegypti infected with Brugia Mala... 46 3.1 1 (DV342499) NABTY57TO Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV342498) NABTY57TF Aedes aegypti infected with Plasmodium ... 46 3.1 1 (DV341993) NABTT83TF Aedes aegypti infected with Plasmodium ... 46 3.1 1
>(AU060751) Dictyostelium discoideum slug cDNA, clone SLB353. Length = 540
Score = 753 bits (380), Expect(2) = 0.0 Identities = 380/380 (100%) Strand = Plus / Plus
Query: 239 gattcaatttaaagggacaacaggccaaagcgcaacacgttgggaaaaaagatggataaa 298 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 gattcaatttaaagggacaacaggccaaagcgcaacacgttgggaaaaaagatggataaa 66
Query: 299 tgtcggacatatgaaacttttaaaatgggtaccaacaaaaataaagagaccaacaccaac 358 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 67 tgtcggacatatgaaacttttaaaatgggtaccaacaaaaataaagagaccaacaccaac 126
Query: 359 acaaggtaatgttagaaaagaaggtggattaacaactagacaaacaccttcacaaaatat 418 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 127 acaaggtaatgttagaaaagaaggtggattaacaactagacaaacaccttcacaaaatat 186
Query: 419 ggaaactagatacacaagatcaaatcgtagagttattggtgataaaaagaatgcagaaca 478 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 187 ggaaactagatacacaagatcaaatcgtagagttattggtgataaaaagaatgcagaaca 246
Query: 479 tgatgaagcatttgaaatgatgtatttaaatagtttaccaaaaacaagaagaaccactaa 538 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 247 tgatgaagcatttgaaatgatgtatttaaatagtttaccaaaaacaagaagaaccactaa 306
Query: 539 aaagatggatttactccaaaagaaacatttacaagatgcaggtttagttgatactgattt 598 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 307 aaagatggatttactccaaaagaaacatttacaagatgcaggtttagttgatactgattt 366
Query: 599 acatgcctcatctgctgatg 618 |||||||||||||||||||| Sbjct: 367 acatgcctcatctgctgatg 386
Score = 210 bits (106), Expect(2) = 0.0 Identities = 106/106 (100%) Strand = Plus / Plus
Query: 668 gagcaccaggtagagttaaatcaatgttatcaccttctcaagatacagcaatgtcaaata 727 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 435 gagcaccaggtagagttaaatcaatgttatcaccttctcaagatacagcaatgtcaaata 494
Query: 728 taggttcagatagtgaattaacttcaaaatcaaatgatgaacaaga 773 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 495 taggttcagatagtgaattaacttcaaaatcaaatgatgaacaaga 540
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 92845959 Number of Hits to DB: 1,103,783,052 Number of extensions: 68438373 Number of successful extensions: 5695298 Number of sequences better than 10.0: 206 Length of query: 1223 Length of database: 95,242,211,685 Length adjustment: 24 Effective length of query: 1199 Effective length of database: 97,308,875,965 Effective search space: 116673342282035 Effective search space used: 116673342282035 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|
protein update |
2009. 6.30 |
Homology vs Protein |
|
PSORT |
|
VS (DIR, S) |
1 |
VH (FL, L) |
0 |
VF (FL, S) |
0 |
AH (FL, L) |
0 |
AF (FL, S) |
0 |
SL (DIR, L) |
1 |
SS (DIR, S) |
0 |
SH (FL, L) |
0 |
SF (FL, S) |
1 |
CH (FL, L) |
2 |
CF (FL, S) |
1 |
FCL (DIR, L) |
0 |
FC (DIR, S) |
0 |
FC-IC (SUB) |
0 |