Contig-U10937-1 |
Contig ID |
Contig-U10937-1 |
Contig update |
2002.12.18 |
Contig sequence |
|
Gap |
gap included |
Contig length |
722 |
Chromosome number (1..6, M) |
5 |
Chromosome length |
5062330 |
Start point |
2804339 |
End point |
2803671 |
Strand (PLUS/MINUS) |
MINUS |
Number of clones |
2 |
Number of EST |
3 |
Link to clone list |
U10937 |
List of clone(s) |
|
Translated Amino Acid sequence |
|
Translated Amino Acid sequence (All Frames) |
|
own update |
2004. 6.10 |
Homology vs CSM-cDNA |
|
dna update |
2008.11.22 |
Homology vs DNA |
Query= Contig-U10937-1 (Contig-U10937-1Q) /CSM_Contig/Contig-U10937-1Q.Seq.d (732 letters)
Database: ddbj_A 92,845,959 sequences; 95,242,211,685 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(BJ326586) Dictyostelium discoideum cDNA clone:dda17h01, 5' ... 807 0.0 1 (BJ343761) Dictyostelium discoideum cDNA clone:dda17h01, 3' ... 416 e-112 1 (BJ406561) Dictyostelium discoideum cDNA clone:dds35n15, 3' ... 188 2e-43 1 (AC117070) Dictyostelium discoideum chromosome 2 map 2097701... 38 2e-06 10 (AC117075) Dictyostelium discoideum chromosome 2 map 5201047... 42 4e-04 9 (C25756) Dictyostelium discoideum gamete cDNA, clone FC-AZ15. 58 5e-04 1 (BQ834829) Po_ad_03H09_TEXF1 Psoroptes ovis mixed Psoroptes ... 52 0.001 2 (AC150891) Medicago truncatula chromosome 2 clone mth2-76a9,... 38 0.003 7 (AM045490) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.005 2 (AM046662) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.005 2 (AC181553) Strongylocentrotus purpuratus clone R3-7G5, WORKI... 42 0.005 7 (AM045383) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.005 2 (AM045891) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.005 2 (AM043350) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.005 2 (AM044258) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM044752) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM047356) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM045874) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM047548) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM047088) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (AM048346) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.006 2 (DY889092) CeleSEQ6614 Cunninghamella elegans pBluescript (E... 40 0.006 2 (DY890753) CeleSEQ9979 Cunninghamella elegans pBluescript (E... 40 0.006 2 (DY890546) CeleSEQ9586 Cunninghamella elegans pBluescript (E... 40 0.006 2 (DY891964) CeleSEQ8835 Cunninghamella elegans pBluescript (E... 40 0.006 2 (AM048232) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.007 2 (AM045705) Schistosoma mansoni lung schistosomulum EST, clon... 46 0.007 2 (AC179512) Strongylocentrotus purpuratus clone R3-6A11, WORK... 54 0.008 1 (AC165428) Strongylocentrotus purpuratus BAC clone contig co... 42 0.008 11 (BJ412816) Dictyostelium discoideum cDNA clone:ddv9p21, 5' e... 38 0.016 3 (CU076078) Zebrafish DNA sequence from clone CH73-309L7 in l... 40 0.018 3 (AC176220) Strongylocentrotus purpuratus clone R3-3062G22, W... 42 0.018 5 (AP005848) Oryza sativa Japonica Group genomic DNA, chromoso... 42 0.020 5 (AC006279) Plasmodium falciparum chromosome 12 clone 3D7, **... 38 0.021 8 (AC178902) Strongylocentrotus purpuratus clone R3-3114N15, W... 46 0.022 5 (EH014571) USDA-FP_187258 Lysiphlebus testaceipes adult whol... 40 0.024 3 (AU264829) Dictyostelium discoideum vegetative cDNA clone:VS... 36 0.026 3 (AC123513) Dictyostelium discoideum strain AX4 chromosome 2 ... 36 0.027 6 (AL928741) Mouse DNA sequence from clone RP23-264P3 on chrom... 52 0.030 1 (Y10158) D.discoideum mRNA for STE20/pak kinase homologue. 52 0.030 1 (U67716) Dictyostelium discoideum myosin I heavy chain kinas... 52 0.030 1 (AC115606) Dictyostelium discoideum chromosome 2 map 159760-... 52 0.030 1 (AL929173) Mouse DNA sequence *** SEQUENCING IN PROGRESS ***... 52 0.030 1 (AC184339) Strongylocentrotus purpuratus clone R3-41J3, WORK... 52 0.030 1 (AC181277) Strongylocentrotus purpuratus clone R3-115K10, WO... 52 0.030 1 (AC180705) Strongylocentrotus purpuratus clone R3-3083N11, W... 52 0.030 1 (AC178143) Strongylocentrotus purpuratus clone R3-3078N5, WO... 52 0.030 1 (AC172376) Strongylocentrotus purpuratus clone R3-1004A11, W... 52 0.030 1 (EJ513773) 1095460159278 Global-Ocean-Sampling_GS-28-01-01-1... 52 0.030 1 (AU267132) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.030 1 (AC095737) Rattus norvegicus clone CH230-9B2, *** SEQUENCING... 40 0.034 5 (AL844509) Plasmodium falciparum chromosome 13. 40 0.041 9 (AU039061) Dictyostelium discoideum slug cDNA, clone SSM334. 36 0.049 3 (AU264828) Dictyostelium discoideum vegetative cDNA clone:VS... 36 0.057 3 (CR450803) Zebrafish DNA sequence from clone DKEY-11O18 in l... 42 0.058 5 (AC023456) Homo sapiens chromosome 15, clone RP11-162P24, co... 40 0.061 7 (AC112626) Rattus norvegicus clone CH230-304H11, *** SEQUENC... 42 0.068 3 (BJ365669) Dictyostelium discoideum cDNA clone:ddc36n01, 5' ... 36 0.075 3 (BJ418976) Dictyostelium discoideum cDNA clone:ddv34l13, 5' ... 36 0.076 3 (BJ422153) Dictyostelium discoideum cDNA clone:ddv45d05, 5' ... 36 0.078 3 (BJ416733) Dictyostelium discoideum cDNA clone:ddv27j02, 5' ... 36 0.079 3 (FG693118) G1144P35RM20.T0 Anolis carolinensis pooled normal... 40 0.087 2 (AC172412) Strongylocentrotus purpuratus clone R3-14G11, WOR... 44 0.090 6 (CP000361) Arcobacter butzleri RM4018, complete genome. 36 0.097 16 (CP000576) Prochlorococcus marinus str. MIT 9301, complete g... 34 0.11 19 (DQ192033) Stizostedion vitreum vitreum putative calpain-lik... 50 0.12 1 (AC120945) Rattus norvegicus clone CH230-285A15, WORKING DRA... 50 0.12 1 (AC112444) Rattus norvegicus clone CH230-231H24, WORKING DRA... 50 0.12 1 (AC192871) Pan troglodytes chromosome X clone CH251-495F12, ... 50 0.12 1 (AC168348) Strongylocentrotus purpuratus clone R3-56O12, WOR... 50 0.12 1 (DU932726) 358830 Tomato EcoRI BAC Library Solanum lycopersi... 50 0.12 1 (AL929357) Plasmodium falciparum strain 3D7, chromosome 9; s... 44 0.12 8 (AC178827) Strongylocentrotus purpuratus clone R3-29G18, WOR... 38 0.12 6 (AC112731) Rattus norvegicus clone CH230-74H2, WORKING DRAFT... 42 0.18 6 (AC117081) Dictyostelium discoideum chromosome 2 map 5862124... 34 0.19 12 (AE014826) Plasmodium falciparum 3D7 chromosome 14 section 1... 38 0.22 9 (BJ429412) Dictyostelium discoideum cDNA clone:ddv3l07, 3' e... 38 0.26 2 (BX255938) Mouse DNA sequence from clone RP23-333B5 on chrom... 40 0.26 2 (AC201147) Strongylocentrotus purpuratus clone R3-14E11, WOR... 44 0.26 6 (EY390039) CAXA852.rev CAXA Helobdella robusta Subtracted La... 46 0.28 2 (AC125938) Rattus norvegicus clone CH230-11B3, *** SEQUENCIN... 42 0.28 6 (CP000123) Mycoplasma capricolum subsp. capricolum ATCC 2734... 40 0.28 17 (AL591111) Human DNA sequence *** SEQUENCING IN PROGRESS ***... 46 0.29 3 (L34219) Homo sapiens retinaldehyde-binding protein (CRALBP)... 44 0.30 2 (CT096804) Sus scrofa genomic clone PigE-191I3, genomic surv... 46 0.31 2 (AL111168) Campylobacter jejuni subsp. jejuni NCTC 11168 com... 34 0.31 16 (AC176445) Strongylocentrotus purpuratus clone R3-3068D24, W... 40 0.32 4 (EY366317) CAXA10666.rev CAXA Helobdella robusta Subtracted ... 46 0.32 2 (AC005504) Plasmodium falciparum chromosome 12, *** SEQUENCI... 42 0.32 4 (FG701485) G1144P347FM15.T0 Anolis carolinensis pooled norma... 40 0.33 2 (AC124068) Homo sapiens chromosome 15, clone RP11-217B1, com... 44 0.33 4 (AZ547010) ENTFU87TR Entamoeba histolytica Sheared DNA Entam... 36 0.34 2 (CU141618) Equus caballus GSS, BAC clone CH241-265H19, T7 en... 34 0.34 2 (BZ519125) BOMSB44TR BO_2_3_KB Brassica oleracea genomic clo... 34 0.35 2 (CU030782) Equus caballus GSS, BAC clone CH241-123M7, T7 end... 34 0.35 2 (AC116924) Dictyostelium discoideum chromosome 2 map 6357117... 40 0.35 5 (AF038919) Dictyostelium discoideum PslA (pslA) gene, comple... 46 0.35 2 (AC120707) Rattus norvegicus clone CH230-42A18, *** SEQUENCI... 42 0.36 3 (CP000814) Campylobacter jejuni subsp. jejuni 81116, complet... 34 0.41 17 (DY887446) CeleSEQ3774 Cunninghamella elegans pBluescript (E... 36 0.42 3
>(BJ326586) Dictyostelium discoideum cDNA clone:dda17h01, 5' end, single read. Length = 420
Score = 807 bits (407), Expect = 0.0 Identities = 419/419 (100%) Strand = Plus / Plus
Query: 1 tactgatagtttaatattatccccaaaacaacataaaggtgaagatagaaaaagaaatca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 tactgatagtttaatattatccccaaaacaacataaaggtgaagatagaaaaagaaatca 60
Query: 61 tgaaatttcatcaatttcaccaccaagatcaagagaaactattggccatgatgatgatga 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tgaaatttcatcaatttcaccaccaagatcaagagaaactattggccatgatgatgatga 120
Query: 121 taataatgttgatgttataccaagacgacaatttaatgaattagaaaaagaatataaaga 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 taataatgttgatgttataccaagacgacaatttaatgaattagaaaaagaatataaaga 180
Query: 181 attaaaacaaatggatgaaactcataaacaatatattgaatcattaaaacttcaaattac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 attaaaacaaatggatgaaactcataaacaatatattgaatcattaaaacttcaaattac 240
Query: 241 acaattggaagaaaaagttaaaaaatcatcaagtcatccacgttcattattacctggnat 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 acaattggaagaaaaagttaaaaaatcatcaagtcatccacgttcattattacctggnat 300
Query: 301 tccttcaaatattaatgattcaccaaaagtagtttatactaaatcttcaattacaaatga 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 tccttcaaatattaatgattcaccaaaagtagtttatactaaatcttcaattacaaatga 360
Query: 361 taatagtagntctcatcatcaacancaacancaacaacataatatatcaccatcaaata 419 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 taatagtagntctcatcatcaacancaacancaacaacataatatatcaccatcaaata 419
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 92845959 Number of Hits to DB: 926,099,583 Number of extensions: 63229793 Number of successful extensions: 6491104 Number of sequences better than 10.0: 1005 Length of query: 732 Length of database: 95,242,211,685 Length adjustment: 24 Effective length of query: 708 Effective length of database: 97,308,875,965 Effective search space: 68894684183220 Effective search space used: 68894684183220 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|
protein update |
2009. 6.28 |
Homology vs Protein |
|
PSORT |
|
VS (DIR, S) |
0 |
VH (FL, L) |
0 |
VF (FL, S) |
0 |
AH (FL, L) |
0 |
AF (FL, S) |
1 |
SL (DIR, L) |
0 |
SS (DIR, S) |
0 |
SH (FL, L) |
1 |
SF (FL, S) |
0 |
CH (FL, L) |
0 |
CF (FL, S) |
0 |
FCL (DIR, L) |
0 |
FC (DIR, S) |
0 |
FC-IC (SUB) |
0 |