NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U06863-1
Contig ID Contig-U06863-1
Contig update 2001. 8.30
Contig sequence 
>Contig-U06863-1 (Contig-U06863-1Q) /CSM_Contig/Contig-U06863-1Q.Seq.d
CCGGAAAAAACAACCAAATATAAAATTAAAATAAATAAATTAATATATAA
ATAAGGCCTTTTATGCCAAGTCATTTTAAAAAATGGGTTAAATTAATTAA
AAAAAAA
Gap no gap
Contig length 107
Chromosome number (1..6, M) 5
Chromosome length 5062330
Start point 2305740
End point 2305633
Strand (PLUS/MINUS) MINUS
Number of clones 1
Number of EST 1
Link to clone list U06863
List of clone(s) 

est1=VSH326F,1,108
Translated Amino Acid sequence 
gknnqi*n*nk*ini*IRPFMPSHFKKWVKLIKKK
Translated Amino Acid sequence (All Frames) 
Frame A:
pekttkykikinkliyk*gllcqvilkngln*lkk


Frame B:
rkkqpniklk*in*yinkafyaksf*kmg*in*kk


Frame C:
gknnqi*n*nk*ini*IRPFMPSHFKKWVKLIKKK
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U06863-1 (Contig-U06863-1Q)
/CSM_Contig/Contig-U06863-1Q.Seq.d
         (107 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U06863-1 (Contig-U06863-1Q) /CSM_Contig/Conti...    88  2e-18
Contig-U12456-1 (Contig-U12456-1Q) /CSM_Contig/Conti...    34  0.026
Contig-U14153-1 (Contig-U14153-1Q) /CSM_Contig/Conti...    32  0.10
Contig-U11701-1 (Contig-U11701-1Q) /CSM_Contig/Conti...    30  0.41
Contig-U04720-1 (Contig-U04720-1Q) /CSM_Contig/Conti...    30  0.41
Contig-U14711-1 (Contig-U14711-1Q) /CSM_Contig/Conti...    28  1.6
Contig-U14572-1 (Contig-U14572-1Q) /CSM_Contig/Conti...    28  1.6
Contig-U11765-1 (Contig-U11765-1Q) /CSM_Contig/Conti...    28  1.6
Contig-U11722-1 (Contig-U11722-1Q) /CSM_Contig/Conti...    28  1.6
Contig-U11187-1 (Contig-U11187-1Q) /CSM_Contig/Conti...    28  1.6

>Contig-U06863-1 (Contig-U06863-1Q) /CSM_Contig/Contig-U06863-1Q.Seq.d
          Length = 107

 Score = 87.7 bits (44), Expect = 2e-18
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                      
Query: 55 ggccttttatgccaagtcattttaaaaaatgggttaaattaatt 98
          ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 55 ggccttttatgccaagtcattttaaaaaatgggttaaattaatt 98


>Contig-U12456-1 (Contig-U12456-1Q) /CSM_Contig/Contig-U12456-1Q.Seq.d
          Length = 1457

 Score = 34.2 bits (17), Expect = 0.026
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 81   aaatgggttaaattaat 97
            |||||||||||||||||
Sbjct: 1105 aaatgggttaaattaat 1121


>Contig-U14153-1 (Contig-U14153-1Q) /CSM_Contig/Contig-U14153-1Q.Seq.d
          Length = 396

 Score = 32.2 bits (16), Expect = 0.10
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                           
Query: 73  attttaaaaaatgggt 88
           ||||||||||||||||
Sbjct: 239 attttaaaaaatgggt 224


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1560
Number of Sequences: 6905
Number of extensions: 1560
Number of successful extensions: 299
Number of sequences better than 10.0: 66
length of query: 107
length of database: 5,674,871
effective HSP length: 14
effective length of query: 93
effective length of database: 5,578,201
effective search space: 518772693
effective search space used: 518772693
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 13 (26.3 bits)
dna update 2008.11.10
Homology vs DNA 
Query= Contig-U06863-1 (Contig-U06863-1Q) /CSM_Contig/Contig-U06863-1Q.Seq.d
         (107 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(AU267266) Dictyostelium discoideum vegetative cDNA clone:VS...    88   6e-14  1
(AC016048) Homo sapiens chromosome 17 clone RP11-98G11, WORK...    48   0.014  2
(AC194551) Pan troglodytes BAC clone CH251-439P20 from chrom...    48   0.054  1
(DD397366) COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TR...    48   0.054  1
(DD334320) A method of testing a sensitivity of tumor cells ...    48   0.054  1
(BD151219) Primer for synthesizing full-length cDNA and use ...    48   0.054  1
(AX871157) Sequence 6062 from Patent EP1074617.                    48   0.054  1
(BC080571) Homo sapiens cDNA clone IMAGE:6538689.                  48   0.054  1
(BC036947) Homo sapiens TBC1 domain family, member 16, mRNA ...    48   0.054  1
(AL512709) Homo sapiens mRNA; cDNA DKFZp762G216 (from clone ...    48   0.054  1
(AL157485) Homo sapiens mRNA; cDNA DKFZp762O207 (from clone ...    48   0.054  1
(AK097283) Homo sapiens cDNA FLJ39964 fis, clone SPLEN2027113.     48   0.054  1
(AK000755) Homo sapiens cDNA FLJ20748 fis, clone HEP05772.         48   0.054  1
(AC116025) Homo sapiens chromosome 17, clone CTD-2529O21, co...    48   0.054  1
(AC100791) Homo sapiens chromosome 17, clone RP11-353N14, co...    48   0.054  1
(AC026373) Homo sapiens chromosome 12 clone RP11-353N14, WOR...    48   0.054  1
(CR936670) Homo sapiens mRNA; cDNA DKFZp451F1311 (from clone...    48   0.054  1
(DR762247) HESC4_138_B07.g1_A037 NIH_MGC_262 Homo sapiens cD...    48   0.054  1
(DB383085) Homo sapiens cDNA clone VESEN1000503, 3' end, mRN...    48   0.054  1
(DB356602) Homo sapiens cDNA clone HEMBA1003714, 3' end, mRN...    48   0.054  1
(DB333729) Homo sapiens cDNA clone SPLEN2027113, 3' end, mRN...    48   0.054  1
(DB263714) Homo sapiens cDNA clone UTERU2022230, 5' end, mRN...    48   0.054  1
(DA882588) Homo sapiens cDNA clone PUAEN2002151, 5' end, mRN...    48   0.054  1
(DA868342) Homo sapiens cDNA clone PROST2003619, 5' end, mRN...    48   0.054  1
(DA780440) Homo sapiens cDNA clone OCBBF2015672, 5' end, mRN...    48   0.054  1
(DA708076) Homo sapiens cDNA clone NT2RI2012779, 5' end, mRN...    48   0.054  1
(DA208899) Homo sapiens cDNA clone BRAWH2016502, 5' end, mRN...    48   0.054  1
(DA056517) Homo sapiens cDNA clone BRACE2002810, 5' end, mRN...    48   0.054  1
(CX163627) HESC2_7_B08.g1_A035 NIH_MGC_258 Homo sapiens cDNA...    48   0.054  1
(CK299810) UI-E-EJ1-ajw-e-03-0-UI.s1 UI-E-EJ1 Homo sapiens c...    48   0.054  1
(CD629605) 56098082J1 FLP Homo sapiens cDNA, mRNA sequence.        48   0.054  1
(CD629604) 56098082H1 FLP Homo sapiens cDNA, mRNA sequence.        48   0.054  1
(CD629602) 56098058H1 FLP Homo sapiens cDNA, mRNA sequence.        48   0.054  1
(CD629601) 56097950J1 FLP Homo sapiens cDNA, mRNA sequence.        48   0.054  1
(AI652499) wb29h05.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone I...    48   0.054  1
(BU633458) UI-H-FL1-bgu-d-20-0-UI.s1 NCI_CGAP_FL1 Homo sapie...    48   0.054  1
(BU528713) AGENCOURT_10183003 NIH_MGC_101 Homo sapiens cDNA ...    48   0.054  1
(BU501023) AGENCOURT_8889186 NIH_MGC_43 Homo sapiens cDNA cl...    48   0.054  1
(BQ890520) AGENCOURT_8071064 NIH_MGC_112 Homo sapiens cDNA c...    48   0.054  1
(BQ188323) UI-E-EJ1-ajw-e-03-0-UI.r1 UI-E-EJ1 Homo sapiens c...    48   0.054  1
(BP227183) Homo sapiens cDNA clone: DMC04858, Sugano cDNA li...    48   0.054  1
(BM666864) UI-E-CL1-aez-d-09-0-UI.s1 UI-E-CL1 Homo sapiens c...    48   0.054  1
(BM449869) AGENCOURT_6392912 NIH_MGC_72 Homo sapiens cDNA cl...    48   0.054  1
(BG954761) CM4-CT0660-120201-870-e02 CT0660 Homo sapiens cDN...    48   0.054  1
(BG954255) CM4-CT0660-080201-869-g02 CT0660 Homo sapiens cDN...    48   0.054  1
(BG761284) 602718342F1 NIH_MGC_49 Homo sapiens cDNA clone IM...    48   0.054  1
(BG281542) 602402080F1 NIH_MGC_20 Homo sapiens cDNA clone IM...    48   0.054  1
(AA494457) ne38b02.s1 NCI_CGAP_Co3 Homo sapiens cDNA clone I...    48   0.054  1
(BF027309) 601671673F1 NIH_MGC_20 Homo sapiens cDNA clone IM...    48   0.054  1
(BE728525) 601561982F1 NIH_MGC_20 Homo sapiens cDNA clone IM...    48   0.054  1
(BE552326) hy06b07.x1 NCI_CGAP_GC6 Homo sapiens cDNA clone I...    48   0.054  1
(AW969436) EST381513 MAGE resequences, MAGK Homo sapiens cDN...    48   0.054  1
(N26714) yx61e10.s1 Soares melanocyte 2NbHM Homo sapiens cDN...    48   0.054  1
(CR293520) Zebrafish DNA sequence from clone CH211-150J10 in...    44   0.84   1
(AC137418) Rattus norvegicus clone CH230-unknown, *** SEQUEN...    44   0.84   1
(DH377208) Oryzias latipes Fosmid clone:GOLWFno775_o14, reve...    44   0.84   1
(CZ536923) SRAA-aad06b01.b1 Strongyloides ratti whole genome...    44   0.84   1
(FD464207) LARW431TR Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD464206) LARW431TF Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD462017) LARVP62TR Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD462016) LARVP62TF Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD459816) LARVB39TR Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD459761) LARVB06TR Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD459760) LARVB06TF Haematobia irritans 1st Instar Larvae H...    44   0.84   1
(FD456071) EGGB546TR Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD456070) EGGB546TF Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD455502) EGGB189TR Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD455303) EGGB069TR Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD455302) EGGB069TF Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD453513) EGGAO11TR Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD453512) EGGAO11TF Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD453168) EGGAM05TR Haematobia irritans eggs Haematobia irr...    44   0.84   1
(FD453167) EGGAM05TF Haematobia irritans eggs Haematobia irr...    44   0.84   1
(BZ159810) CH230-327P9.TJ CHORI-230 Segment 2 Rattus norvegi...    32   1.0    2
(AC175329) Bos taurus clone CH240-515J13, WORKING DRAFT SEQU...    32   1.7    2
(AC165592) Bos taurus clone CH240-169L20, WORKING DRAFT SEQU...    32   1.7    2
(DV884921) LB0266.CR_H01 GC_BGC-26 Bos taurus cDNA clone IMA...    32   2.2    2
(EE375477) LB03060.CR_E15 GC_BGC-30 Bos taurus cDNA clone IM...    32   2.2    2
(EE333053) LB01632.CR_B07 GC_BGC-16 Bos taurus cDNA clone IM...    32   2.2    2
(DV813844) LB01711.CR_H12 GC_BGC-17 Bos taurus cDNA clone IM...    32   2.2    2
(BE809248) 214646 MARC 2BOV Bos taurus cDNA 5', mRNA sequence.     32   2.3    2
(BE753302) 206271 MARC 2BOV Bos taurus cDNA 5', mRNA sequence.     32   2.3    2
(DY081391) 000731BMLB002267HT BMLB Bos taurus cDNA 5', mRNA ...    32   2.3    2
(DY087182) 000730BMLB002458HT BMLB Bos taurus cDNA 5', mRNA ...    32   2.3    2
(DY071445) 000730BMLB002340HT BMLB Bos taurus cDNA 5', mRNA ...    32   2.3    2
(DY150828) 000730BMLB002370HT BMLB Bos taurus cDNA 5', mRNA ...    32   2.3    2
(EF410867) Synthetic construct Bacillus anthracis clone FLH2...    42   3.3    1
(CU468262) M.truncatula DNA sequence from clone MTH2-34E14 o...    42   3.3    1
(AC118907) Rattus norvegicus clone CH230-202H16, *** SEQUENC...    42   3.3    1
(AC105889) Rattus norvegicus clone CH230-167O3, WORKING DRAF...    42   3.3    1
(DH699924) Rattus norvegicus DNA, BAC clone: RNB1-259L15, 3'...    42   3.3    1
(DH541076) Rattus norvegicus DNA, BAC clone: RNB1-045N08, 5'...    42   3.3    1
(BZ270393) CH230-263G10.TJ CHORI-230 Segment 2 Rattus norveg...    42   3.3    1
(CP000485) Bacillus thuringiensis str. Al Hakam, complete ge...    42   3.3    1
(AE017334) Bacillus anthracis str. 'Ames Ancestor', complete...    42   3.3    1
(AE017225) Bacillus anthracis str. Sterne, complete genome.        42   3.3    1
(AE016879) Bacillus anthracis str. Ames, complete genome.          42   3.3    1
(CZ958446) 308184 Tomato EcoRI BAC Library Solanum lycopersi...    38   4.6    2

>(AU267266) Dictyostelium discoideum vegetative cDNA clone:VSH326,
          5' end single read.
          Length = 108

 Score = 87.7 bits (44), Expect = 6e-14
 Identities = 44/44 (100%)
 Strand = Plus / Plus


Query: 55 ggccttttatgccaagtcattttaaaaaatgggttaaattaatt 98
          ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 55 ggccttttatgccaagtcattttaaaaaatgggttaaattaatt 98

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 78,914,511
Number of extensions: 6366291
Number of successful extensions: 1740483
Number of sequences better than 10.0: 98
Length of query: 107
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 85
Effective length of database: 93,199,600,587
Effective search space: 7921966049895
Effective search space used: 7921966049895
X1: 11 (21.8 bits)
S2: 20 (40.1 bits)
protein update 2009. 6.23
Homology vs Protein 
Query= Contig-U06863-1 (Contig-U06863-1Q) /CSM_Contig/Contig-U06863-1Q.Seq.d
         (107 letters)

Database: nrp_A
           3,204,285 sequences; 1,040,966,779 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3204285
Number of Hits to DB: 71,058,644
Number of extensions: 746220
Number of successful extensions: 1047
Number of sequences better than 10.0: 0
Number of HSP's gapped: 1047
Number of HSP's successfully gapped: 0
Length of query: 35
Length of database: 1,040,966,779
Length adjustment: 9
Effective length of query: 26
Effective length of database: 1,012,128,214
Effective search space: 26315333564
Effective search space used: 26315333564
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 24 (13.9 bits)
PSORT -
VS (DIR, S) 1
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 0
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0