>Contig-U06722-1 (Contig-U06722-1Q) /CSM_Contig/Contig-U06722-1Q.Seq.d
GTAAAAAAATAATAATAATAATAATAATAATAATAATAATAATAATAATA
ATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAATAAT
AATANGANCAAANCAAANCAAAAATAAATAANTTAAATAATNAAAANAAA
AAAATTAAANNGGAAAATAAATAAGAAAAAAAAA

est1=VSF561F,1,185

KKIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIXXXQXKNK*xk*xkxkn*xgk*irkk

Frame A:
vkk*******************************xxqxkxkinxlnnxxkkikxenk*ek
k


Frame B:
*knnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxkxxqk*ix*ixkxkklxxkinkkk
k


Frame C:
KKIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIXXXQXKNK*xk*xkxkn*xgk*irkk

Query= Contig-U06722-1 (Contig-U06722-1Q) /CSM_Contig/Contig-U06722-1Q.Seq.d
         (184 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 0
Number of sequences better than 10.0: 0
Length of query: 184
Length of database: 95,242,211,685
Length adjustment: 22
Effective length of query: 162
Effective length of database: 93,199,600,587
Effective search space: 15098335295094
Effective search space used: 15098335295094
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)

Query= Contig-U06722-1 (Contig-U06722-1Q) /CSM_Contig/Contig-U06722-1Q.Seq.d
         (184 letters)

Database: nrp_A
           3,204,285 sequences; 1,040,966,779 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3204285
Number of Hits to DB: 14,971,928
Number of extensions: 19346
Number of sequences better than 10.0: 0
Number of HSP's gapped: 0
Number of HSP's successfully gapped: 0
Length of query: 61
Length of database: 1,040,966,779
Length adjustment: 33
Effective length of query: 28
Effective length of database: 935,225,374
Effective search space: 26186310472
Effective search space used: 26186310472
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)

 psg: 1.01  gvh: 0.51  alm: -0.10  top: 0.47  tms: 0.13  mit: 0.39  mip: 0.00
 nuc: 0.00  erl: 0.00  erm: 0.20  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 1.00  m3b: 0.00  m_ : 0.00 

	 40.0 %: endoplasmic reticulum
	 20.0 %: mitochondrial
	 16.0 %: plasma membrane
	  8.0 %: extracellular, including cell wall
	  4.0 %: cytoplasmic
	  4.0 %: Golgi
	  4.0 %: vacuolar
	  4.0 %: vesicles of secretory system

>> prediction for Contig-U06722-1 is end