NBDC - アーカイブトップ - ヘルプ
データベースの説明 | データ項目の説明 | 利用許諾 | ヘルプ
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
NBDC - LSDB Archive
Description of this DB | Description of data items | Download | License
Dicty_cDB
Contig List | Clone List | cDNA Library List
Atlas
Atlas | Atlas Image List
Contig-U06681-1
Contig ID Contig-U06681-1
Contig update 2001. 8.30
Contig sequence 
>Contig-U06681-1 (Contig-U06681-1Q) /CSM_Contig/Contig-U06681-1Q.Seq.d
AAATTAAATTATTATAATTAACTGCGTNTATCACTAAAAATATGAAAAAA
AGATTATATTTTTATTTTTTATTACTTAAAATCGGGTTCAATCAAAAATG
ATAGCCAATATACTTTGTCTTTAAAAATAGAATTATTTAATTTTATTTCT
TATTTTTATTTATAAGCNAAGGAAAAAAAAAAAANGGGGGAANAAAAAA
Gap no gap
Contig length 199
Chromosome number (1..6, M) 1
Chromosome length 4919822
Start point 3483156
End point 3483262
Strand (PLUS/MINUS) PLUS
Number of clones 1
Number of EST 1
Link to clone list U06681
List of clone(s) 

est1=VSF129F,1,200
Translated Amino Acid sequence 
klnyyn*lrxslki*KKDYIFIFYYLKSGSIKNDSQYTLSLKIELFNFISYFYL*akekk
kxgexk
Translated Amino Acid sequence (All Frames) 
Frame A:
klnyyn*lrxslki*KKDYIFIFYYLKSGSIKNDSQYTLSLKIELFNFISYFYL*akekk
kxgexk


Frame B:
n*iiiincvyh*kyekkiiflffit*nrvqskmianilcl*k*nylilflifiykxrkkk
kxgxkk


Frame C:
ikll*ltaxitknmkkrlyfyflllkigfnqk**piyfvfknrii*fyflflfisxgkkk
xggxk
own update 2004. 6.10
Homology vs CSM-cDNA 
Query= Contig-U06681-1 (Contig-U06681-1Q)
/CSM_Contig/Contig-U06681-1Q.Seq.d
         (199 letters)

Database: CSM
           6905 sequences; 5,674,871 total letters


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

Contig-U06681-1 (Contig-U06681-1Q) /CSM_Contig/Conti...   119  1e-27
Contig-U06406-1 (Contig-U06406-1Q) /CSM_Contig/Conti...    38  0.003
Contig-U10309-1 (Contig-U10309-1Q) /CSM_Contig/Conti...    36  0.013
Contig-U07094-1 (Contig-U07094-1Q) /CSM_Contig/Conti...    34  0.052
Contig-U06651-1 (Contig-U06651-1Q) /CSM_Contig/Conti...    34  0.052
Contig-U04460-1 (Contig-U04460-1Q) /CSM_Contig/Conti...    34  0.052
Contig-U12907-1 (Contig-U12907-1Q) /CSM_Contig/Conti...    32  0.21
Contig-U12523-1 (Contig-U12523-1Q) /CSM_Contig/Conti...    32  0.21
Contig-U12146-1 (Contig-U12146-1Q) /CSM_Contig/Conti...    32  0.21
Contig-U11837-1 (Contig-U11837-1Q) /CSM_Contig/Conti...    32  0.21

>Contig-U06681-1 (Contig-U06681-1Q) /CSM_Contig/Contig-U06681-1Q.Seq.d
          Length = 199

 Score =  119 bits (60), Expect = 1e-27
 Identities = 60/60 (100%)
 Strand = Plus / Plus

                                                                       
Query: 71  attacttaaaatcgggttcaatcaaaaatgatagccaatatactttgtctttaaaaatag 130
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 71  attacttaaaatcgggttcaatcaaaaatgatagccaatatactttgtctttaaaaatag 130


 Score = 81.8 bits (41), Expect = 2e-16
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                      
Query: 1  aaattaaattattataattaactgcgtntatcactaaaaatatg 44
          ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  aaattaaattattataattaactgcgtntatcactaaaaatatg 44


>Contig-U06406-1 (Contig-U06406-1Q) /CSM_Contig/Contig-U06406-1Q.Seq.d
          Length = 571

 Score = 38.2 bits (19), Expect = 0.003
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 2  aattaaattattataatta 20
          |||||||||||||||||||
Sbjct: 39 aattaaattattataatta 57


>Contig-U10309-1 (Contig-U10309-1Q) /CSM_Contig/Contig-U10309-1Q.Seq.d
          Length = 1136

 Score = 36.2 bits (18), Expect = 0.013
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 4   ttaaattattataattaa 21
           ||||||||||||||||||
Sbjct: 126 ttaaattattataattaa 109


  Database: CSM
    Posted date:  Jun 9, 2004  7:35 PM
  Number of letters in database: 5,674,871
  Number of sequences in database:  6905
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2389
Number of Sequences: 6905
Number of extensions: 2389
Number of successful extensions: 979
Number of sequences better than 10.0: 113
length of query: 199
length of database: 5,674,871
effective HSP length: 15
effective length of query: 184
effective length of database: 5,571,296
effective search space: 1025118464
effective search space used: 1025118464
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)
dna update 2008.11. 9
Homology vs DNA 
Query= Contig-U06681-1 (Contig-U06681-1Q) /CSM_Contig/Contig-U06681-1Q.Seq.d
         (199 letters)

Database: ddbj_A
           92,845,959 sequences; 95,242,211,685 total letters

Searching..................................................done

                                                             Score    E
Sequences producing significant alignments:                  (bits) Value  N

(AU264753) Dictyostelium discoideum vegetative cDNA clone:VS...   121   3e-42  2
(BZ398717) EINBI23TF EI_10_12_KB Entamoeba invadens genomic ...    38   0.95   2
(AC128340) Rattus norvegicus clone CH230-188O10, *** SEQUENC...    44   1.7    1
(AC119484) Rattus norvegicus clone CH230-38A24, *** SEQUENCI...    44   1.7    1
(CT027653) Zebrafish DNA sequence from clone DKEY-157K16 in ...    42   6.8    1
(BV675614) S217P61647FF3.T0 Noemie Pan troglodytes troglodyt...    42   6.8    1
(BV369395) S231P6310RF5.T0 BedlingtonTerrier Canis familiari...    42   6.8    1
(AL929409) Mouse DNA sequence from clone RP23-402H11 on chro...    42   6.8    1
(AC134844) Mus musculus BAC clone RP24-398A1 from chromosome...    42   6.8    1
(CS730535) Sequence 465 from Patent WO2007095469.                  42   6.8    1
(AL353736) Human DNA sequence from clone RP11-412P1 on chrom...    42   6.8    1
(AC082650) Homo sapiens BAC clone RP11-419L4 from 4, complet...    42   6.8    1
(AC006952) Homo sapiens chromosome 9, clone hRPK.374_B_16, c...    42   6.8    1
(AC139390) Rattus norvegicus clone CH230-84B5, *** SEQUENCIN...    42   6.8    1
(AC096111) Rattus norvegicus clone CH230-29A22, *** SEQUENCI...    42   6.8    1
(CT583725) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS...    42   6.8    1
(AP007716) Lotus japonicus genomic DNA, chromosome 4, clone:...    42   6.8    1
(AC178855) Strongylocentrotus purpuratus clone R3-26H8, WORK...    42   6.8    1
(AC176746) Strongylocentrotus purpuratus clone R3-3097F6, WO...    42   6.8    1
(AC169238) Bos taurus clone CH240-232N5, WORKING DRAFT SEQUE...    42   6.8    1
(FH371447) CHO_OF4520xl12f1.ab1 CHO_OF4 Nicotiana tabacum ge...    42   6.8    1
(EJ898583) 1093018478128 Global-Ocean-Sampling_GS-30-02-01-1...    42   6.8    1
(AM618496) Entamoeba invadens IP1 GSS, clone inv112d02.p1k.        42   6.8    1
(AM608585) Entamoeba invadens IP1 GSS, clone inv090e02.q1k.        42   6.8    1
(AM607036) Entamoeba invadens IP1 GSS, clone inv073h08.q1k.        42   6.8    1
(AM603919) Entamoeba invadens IP1 GSS, clone inv029g02.p1k.        42   6.8    1
(EJ790366) 1093017375066 Global-Ocean-Sampling_GS-30-02-01-1...    42   6.8    1
(CW170258) 104_580_11155112_148_36511_022 Sorghum methylatio...    42   6.8    1
(CL492977) SAIL_571_H02.v1 SAIL Collection Arabidopsis thali...    42   6.8    1
(BZ399476) EINDW69TR EI_10_12_KB Entamoeba invadens genomic ...    42   6.8    1
(BZ158107) CH230-387C20.TJ CHORI-230 Segment 2 Rattus norveg...    42   6.8    1
(EH012455) USDA-FP_185354 Lysiphlebus testaceipes adult whol...    42   6.8    1
(EH012176) USDA-FP_185102 Lysiphlebus testaceipes adult whol...    42   6.8    1
(FK866117) 0000099273G23 D. serrata mRNA from different deve...    42   6.8    1
(DQ884676) Hylaeus ofarrelli voucher KM251 elongation factor...    36   7.3    2

>(AU264753) Dictyostelium discoideum vegetative cDNA clone:VSF129,
           5' end single read.
          Length = 200

 Score =  121 bits (61), Expect(2) = 3e-42
 Identities = 61/61 (100%)
 Strand = Plus / Plus


Query: 71  attacttaaaatcgggttcaatcaaaaatgatagccaatatactttgtctttaaaaatag 130
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 71  attacttaaaatcgggttcaatcaaaaatgatagccaatatactttgtctttaaaaatag 130


Query: 131 a 131
           |
Sbjct: 131 a 131

 Score = 81.8 bits (41), Expect(2) = 3e-42
 Identities = 44/44 (100%)
 Strand = Plus / Plus


Query: 1  aaattaaattattataattaactgcgtntatcactaaaaatatg 44
          ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  aaattaaattattataattaactgcgtntatcactaaaaatatg 44

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Sequences: 92845959
Number of Hits to DB: 148,837,398
Number of extensions: 9088741
Number of successful extensions: 2534702
Number of sequences better than 10.0: 35
Length of query: 199
Length of database: 95,242,211,685
Length adjustment: 23
Effective length of query: 176
Effective length of database: 93,106,754,628
Effective search space: 16386788814528
Effective search space used: 16386788814528
X1: 11 (21.8 bits)
S2: 21 (42.1 bits)
protein update 2009. 6.22
Homology vs Protein 
Query= Contig-U06681-1 (Contig-U06681-1Q) /CSM_Contig/Contig-U06681-1Q.Seq.d
         (199 letters)

Database: nrp_A
           3,204,285 sequences; 1,040,966,779 total letters

Searching..................................................done

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3204285
Number of Hits to DB: 204,772,900
Number of extensions: 2907233
Number of successful extensions: 3884
Number of sequences better than 10.0: 0
Number of HSP's gapped: 3883
Number of HSP's successfully gapped: 0
Length of query: 66
Length of database: 1,040,966,779
Length adjustment: 38
Effective length of query: 28
Effective length of database: 919,203,949
Effective search space: 25737710572
Effective search space used: 25737710572
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 26 (14.6 bits)
PSORT 

 psg: 0.90  gvh: 0.28  alm: 0.45  top: 0.47  tms: 0.00  mit: 0.18  mip: 0.00
 nuc: 0.00  erl: 0.00  erm: 0.00  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 0.00  m3b: 0.00  m_ : 1.00 

	 36.0 %: cytoplasmic
	 36.0 %: nuclear
	 12.0 %: cytoskeletal
	  4.0 %: mitochondrial
	  4.0 %: vacuolar
	  4.0 %: plasma membrane
	  4.0 %: vesicles of secretory system

>> prediction for Contig-U06681-1 is cyt
VS (DIR, S) 1
VH (FL, L) 0
VF (FL, S) 0
AH (FL, L) 0
AF (FL, S) 0
SL (DIR, L) 0
SS (DIR, S) 0
SH (FL, L) 0
SF (FL, S) 0
CH (FL, L) 0
CF (FL, S) 0
FCL (DIR, L) 0
FC (DIR, S) 0
FC-IC (SUB) 0