Homology vs DNA |
Query= Contig-U05312-1 (Contig-U05312-1Q) /CSM_Contig/Contig-U05312-1Q.Seq.d (480 letters)
Database: ddbj_B 105,743,758 sequences; 104,622,809,269 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AU269026) Dictyostelium discoideum vegetative cDNA clone:VS... 805 0.0 1 (AU265542) Dictyostelium discoideum vegetative cDNA clone:VS... 753 0.0 1 (AU265543) Dictyostelium discoideum vegetative cDNA clone:VS... 747 0.0 1 (AU038001) Dictyostelium discoideum slug cDNA, clone SSH143. 737 0.0 1 (AU269027) Dictyostelium discoideum vegetative cDNA clone:VS... 716 0.0 2 (AU266015) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.002 2 (AU268940) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.002 2 (DV774433) McClintock41_B07.ab1 Homarus EST library project ... 54 0.005 1 (AU269391) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU269273) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU269228) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU269201) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU266852) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU266645) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU266108) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU266104) Dictyostelium discoideum vegetative cDNA clone:VS... 54 0.005 1 (AU269381) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU269337) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU269176) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU268958) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU266788) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU266778) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU266370) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU266229) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (AU266151) Dictyostelium discoideum vegetative cDNA clone:VS... 52 0.020 1 (CF338151) JMT--08-O08.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF338000) JMT--08-K22.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337938) JMT--08-J12.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337901) JMT--08-I16.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337756) JMT--08-F10.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337748) JMT--08-F06.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337576) JMT--08-B09.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337557) JMT--08-A18.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (CF337548) JMT--08-A13.b1 AtJMT-overexpressing transgenic ri... 52 0.020 1 (FC359500) CAYY31872.fwd CAYY Physcomitrella patens subsp. p... 52 0.020 1 (EY824557) PT11-C1-901-068-D12-CT.F Poncirus trifoliata leaf... 52 0.020 1 (DV774955) McClintock_50_D05.ab1 Homarus EST library project... 44 0.034 2 (CT698774) Danio rerio EST, clone ZF_mu_201g13 3'. 38 0.044 3 (CU606878) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 50 0.080 1 (CU582968) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 50 0.080 1 (AC176732) Strongylocentrotus purpuratus clone R3-3096N5, WO... 50 0.080 1 (DN578186) 92231624 Sea Urchin primary mesenchyme cell cDNA ... 50 0.080 1 (CJ367597) Molgula tectiformis cDNA, gastrula/neurula clone:... 50 0.080 1 (CD294477) StrPu537.009509 Sea urchin embryo 20hr blastula s... 50 0.080 1 (BB975725) Plasmodium berghei str. ANKA cDNA clone: OK005571... 50 0.080 1 (EY798930) CR05-C3-701-070-D05-CT.F Mandarin fruit, developm... 50 0.080 1 (EY769273) CR05-C1-102-029-C03-CT.F Mandarin leaf, infected ... 50 0.080 1 (EY768386) CR05-C1-102-027-C10-CT.F Mandarin leaf, infected ... 50 0.080 1 (EY692007) CS00-C2-003-086-D10-CT.F Sweet orange bark, green... 50 0.080 1 (EY657225) CS00-C1-100-079-E11-CT.F Sweet orange leaf, green... 50 0.080 1 (CT627203) Danio rerio EST, clone ZF_mu_74o06 3'. 46 0.14 2 (EY861739) CM30-C1-401-028-H02-CT.F Sweet lime leaf, infecte... 42 0.18 2 (EY709841) CS00-C3-701-002-A06-CT.F Sweet orange fruit, deve... 40 0.27 2 (DN791751) 90805571 Sea Urchin primary mesenchyme cell cDNA ... 48 0.32 1 (CV874246) PDUts1124F05 Porcine testis cDNA library I Sus sc... 48 0.32 1 (CT631096) Danio rerio EST, clone ZF_mu_108k09 3'. 48 0.32 1 (CT615040) Danio rerio EST, clone ZF_mu_77i01 3'. 48 0.32 1 (CF586318) AGENCOURT_8863446_updated NIH_MGC_139 Mus musculu... 48 0.32 1 (BB975645) Plasmodium berghei str. ANKA cDNA clone: OK005486... 48 0.32 1 (BB974809) Plasmodium berghei str. ANKA cDNA clone: OK004624... 48 0.32 1 (BB973318) Plasmodium berghei str. ANKA cDNA clone: OK003095... 48 0.32 1 (BB973134) Plasmodium berghei str. ANKA cDNA clone: OK002870... 48 0.32 1 (EY885875) LT33-C1-003-011-H03-CT.F Tahiti lime leaf, greenh... 48 0.32 1 (EY843476) CA26-C1-002-015-D06-CT.F Sour orange leaf, field ... 48 0.32 1 (EY838663) PT11-C9-005-007-F12-CT.F Poncirus trifoliata seed... 48 0.32 1 (EY816232) PT11-C1-900-071-H12-CT.F Poncirus trifoliata leaf... 48 0.32 1 (EY796659) CR05-C3-701-042-F05-CT.F Mandarin fruit, developm... 48 0.32 1 (EV130322) 0162435 Brassica napus Flower Brassica napus cDNA... 48 0.32 1 (CV870264) PDUts1077C05 Porcine testis cDNA library I Sus sc... 40 0.44 2 (AC168694) Strongylocentrotus purpuratus clone R3-3014H9, WO... 36 0.53 8 (EY795432) CR05-C3-701-031-A12-CT.F Mandarin fruit, developm... 42 0.56 2 (EY773754) CR05-C1-102-092-H05-CT.F Mandarin leaf, infected ... 40 0.57 2 (EY780974) CR05-C1-103-072-G09-CT.F Mandarin leaf, infected ... 40 0.57 2 (CV966924) PC014H03 infected tomato, center of lesion 3 dpi ... 38 0.58 2 (EY815014) PT11-C1-900-058-B03-CT.F Poncirus trifoliata leaf... 40 0.64 2 (DN790979) 90807331 Sea Urchin primary mesenchyme cell cDNA ... 40 0.65 2 (CC152314) CSU-K34.124M17.T7 CSU-K34 Aedes aegypti genomic c... 34 0.88 2 (EY896492) RR1ED53JQ RR1(CS) Raphanus raphanistrum subsp. ma... 36 0.88 2 (ER531170) 1093015752258 Global-Ocean-Sampling_GS-35-01-01-1... 36 0.89 2 (EX760637) RR2CI33JQ RR2(MS) Raphanus raphanistrum subsp. ra... 36 0.89 2 (CT626411) Danio rerio EST, clone ZF_mu_76h05 3'. 38 1.2 2 (BX571947) Zebrafish DNA sequence from clone DKEY-162F21 in ... 46 1.2 1 (AC125222) Mus musculus BAC clone RP23-83G5 from 8, complete... 46 1.2 1 (AC108782) Mus musculus chromosome 8, clone RP23-350C11, com... 46 1.2 1 (FP089570) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 46 1.2 1 (AC169249) Bos taurus clone CH240-252H17, WORKING DRAFT SEQU... 46 1.2 1 (AC165450) Bos taurus clone CH240-327K3, WORKING DRAFT SEQUE... 46 1.2 1 (FI239826) CccaBb016-D13JF CccABb Cajanus cajan genomic clon... 46 1.2 1 (FI233925) CccaBb023-E6JR CccABb Cajanus cajan genomic clone... 46 1.2 1 (DE241120) Trifolium pratense DNA, clone:RCG44513. 46 1.2 1 (ES429232) Plate_12b_A04 Hibernating 13-lined squirrel brain... 46 1.2 1 (DN791814) 90885461 Sea Urchin primary mesenchyme cell cDNA ... 46 1.2 1 (DN789961) 90820089 Sea Urchin primary mesenchyme cell cDNA ... 46 1.2 1 (DN784207) 92221527 Sea Urchin primary mesenchyme cell cDNA ... 46 1.2 1 (DC228196) Plasmodium berghei strain ANKA cDNA clone:SG01143... 46 1.2 1 (DC213411) Plasmodium berghei strain ANKA cDNA clone:MG01509... 46 1.2 1 (CV877151) PDUts1160G12 Porcine testis cDNA library I Sus sc... 46 1.2 1 (CT729188) Danio rerio EST, clone ZF_mu_262a16 3'. 46 1.2 1 (CT682849) Danio rerio EST, clone ZF_mu_220o14 5'. 46 1.2 1 (CT634406) Danio rerio EST, clone ZF_mu_86f14 3'. 46 1.2 1 (CT628751) Danio rerio EST, clone ZF_mu_62i19 5'. 46 1.2 1 (CT625779) Danio rerio EST, clone ZF_mu_61h05 3'. 46 1.2 1 (CT622139) Danio rerio EST, clone ZF_mu_76m06 3'. 46 1.2 1 (CT620026) Danio rerio EST, clone ZF_mu_77b17 5'. 46 1.2 1 (CT585623) Danio rerio EST, clone ZF_mu_47g14 5'. 46 1.2 1 (CT584076) Danio rerio EST, clone ZF_mu_48d01 3'. 46 1.2 1 (CK415565) AUF_IpPit_32_p21 Pituitary cDNA library Ictalurus... 46 1.2 1 (CJ984179) Bursaphelenchus xylophilus cDNA clone: Bx_K1_63G0... 46 1.2 1 (CJ981002) Bursaphelenchus xylophilus cDNA clone: Bx_K1_27G0... 46 1.2 1 (CJ371521) Molgula tectiformis cDNA, gastrula/neurula clone:... 46 1.2 1 (CJ355265) Molgula tectiformis cDNA, cleaving embryo clone:m... 46 1.2 1 (BB975205) Plasmodium berghei str. ANKA cDNA clone: OK005027... 46 1.2 1 (BB974645) Plasmodium berghei str. ANKA cDNA clone: OK004457... 46 1.2 1 (BB973875) Plasmodium berghei str. ANKA cDNA clone: OK003664... 46 1.2 1 (BB973660) Plasmodium berghei str. ANKA cDNA clone: OK003443... 46 1.2 1 (BB973585) Plasmodium berghei str. ANKA cDNA clone: OK003368... 46 1.2 1 (BB973008) Plasmodium berghei str. ANKA cDNA clone: OK002740... 46 1.2 1 (BB972724) Plasmodium berghei str. ANKA cDNA clone: OK002451... 46 1.2 1 (FG632168) TOBESTR130F04 TOBEST cDNA library 1 Nicotiana tab... 46 1.2 1 (FC765020) CBBN1827.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 46 1.2 1 (EY826214) PT11-C1-901-073-A03-CT.F Poncirus trifoliata leaf... 46 1.2 1 (EY825111) PT11-C1-901-072-F02-CT.F Poncirus trifoliata leaf... 46 1.2 1 (EY800575) CR05-C3-701-098-F02-CT.F Mandarin fruit, developm... 46 1.2 1 (EY797104) CR05-C3-701-048-G06-CT.F Mandarin fruit, developm... 46 1.2 1 (EY790927) CR05-C3-700-017-B07-CT.F Mandarin fruit, developm... 46 1.2 1 (EY782688) CR05-C1-103-092-G09-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY781196) CR05-C1-103-076-E05-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY777848) CR05-C1-103-037-G10-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY776112) CR05-C1-103-012-A11-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY775412) CR05-C1-103-003-G08-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY774708) CR05-C1-102-100-E05-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY773132) CR05-C1-102-075-E03-CT.F Mandarin leaf, infected ... 46 1.2 1 (EY753222) CS00-C5-003-083-C12-CT.F Sweet orange flower, gre... 46 1.2 1 (EY743819) CS00-C3-705-108-D06-CT.F Sweet orange fruit, deve... 46 1.2 1 (EY734382) CS00-C3-704-086-G09-CT.F Sweet orange fruit, deve... 46 1.2 1 (EY710752) CS00-C3-701-086-G06-CT.F Sweet orange fruit, deve... 46 1.2 1 (EY683699) CS00-C1-650-039-F04-CT.F Sweet orange leaf, young... 46 1.2 1 (EY667563) CS00-C1-102-033-H05-CT.F Sweet orange leaf, infec... 46 1.2 1 (EV203225) 0104378 Brassica napus Cold acclimation - light B... 46 1.2 1 (EV137646) 0203572 Brassica napus Very early anther Brassica... 46 1.2 1 (BB975772) Plasmodium berghei str. ANKA cDNA clone: OK005620... 38 1.3 2 (AC209194) Populus trichocarpa clone POP091-C08, complete se... 40 1.3 5 (BB975709) Plasmodium berghei str. ANKA cDNA clone: OK005554... 40 1.4 2 (BB975690) Plasmodium berghei str. ANKA cDNA clone: OK005535... 42 1.5 2 (DC217433) Plasmodium berghei strain ANKA cDNA clone:MG02033... 42 1.6 2 (CT641421) Danio rerio EST, clone ZF_mu_74a11 5'. 38 1.6 2 (CJ352106) Molgula tectiformis cDNA, cleaving embryo clone:m... 42 1.7 2 (BB976286) Plasmodium berghei str. ANKA cDNA clone: OK006158... 38 1.8 2 (CT668095) Danio rerio EST, clone ZF_mu_152d10 3'. 38 1.8 2 (CT634182) Danio rerio EST, clone ZF_mu_86k02 3'. 38 1.8 2 (AC114121) Rattus norvegicus clone CH230-25F23, *** SEQUENCI... 36 1.9 4 (EJ590347) 1092961046168 Global-Ocean-Sampling_GS-29-01-01-1... 38 2.0 2 (CT601744) Danio rerio EST, clone ZF_mu_89o16 5'. 38 2.0 2 (EY776936) CR05-C1-103-027-F09-CT.F Mandarin leaf, infected ... 38 2.0 2 (CT598062) Danio rerio EST, clone ZF_mu_89b12 3'. 36 2.0 2 (EY851600) CG32-C1-003-005-A11-CT.F Mexican lime leaf, green... 38 2.1 2 (CV966922) PC014G12 infected tomato, center of lesion 3 dpi ... 42 2.1 2 (EY799225) CR05-C3-701-059-E02-CT.F Mandarin fruit, developm... 38 2.1 2 (EY775076) CR05-C1-102-098-H05-CT.F Mandarin leaf, infected ... 38 2.2 2 (EY741883) CS00-C3-705-002-F06-CT.F Sweet orange fruit, deve... 38 2.2 2 (EY781993) CR05-C1-103-084-F08-CT.F Mandarin leaf, infected ... 42 2.2 2 (DN782081) 90187235 Sea Urchin primary mesenchyme cell cDNA ... 42 2.2 2 (EY710093) CS00-C3-701-111-H01-CT.F Sweet orange fruit, deve... 40 2.3 2 (DN789970) 90879867 Sea Urchin primary mesenchyme cell cDNA ... 42 2.3 2 (DN783997) 94026053 Sea Urchin primary mesenchyme cell cDNA ... 40 2.3 2 (EY881218) LT33-C1-003-053-C04-CT.F Tahiti lime leaf, greenh... 38 2.3 2 (DN784061) 90169491 Sea Urchin primary mesenchyme cell cDNA ... 38 2.4 2 (DN791936) 90176885 Sea Urchin primary mesenchyme cell cDNA ... 42 2.4 2 (DN785133) 91575292 Sea Urchin primary mesenchyme cell cDNA ... 42 2.4 2 (DN782766) 90158319 Sea Urchin primary mesenchyme cell cDNA ... 38 2.4 2 (DV018157) CA8E07_T7 Diploptera punctata corpora allata cDNA... 42 2.7 2 (EY736435) CS00-C3-705-016-C09-CT.F Sweet orange fruit, deve... 34 3.3 2 (BI511797) BB160007A10F03.5 Bee Brain Normalized Library, BB... 32 3.3 2 (DW679104) EST002585 Trichophyton rubrum cDNA library 0 Tric... 40 3.6 2 (CJ353876) Molgula tectiformis cDNA, cleaving embryo clone:m... 30 3.7 3 (U36837) Lactococcus lactis plasmid pNP40, abortive infectio... 40 3.9 2 (CR925703) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 34 4.1 4 (AC148171) Medicago truncatula clone mth2-30a2, complete seq... 32 4.1 6 (BX927349) Zebrafish DNA sequence from clone DKEY-84K15 in l... 34 4.3 6 (FG632173) TOBESTR130F10 TOBEST cDNA library 1 Nicotiana tab... 40 4.6 2 (FG624750) TOBESTR040G08 TOBEST cDNA library 1 Nicotiana tab... 40 4.6 2 (DC233728) Plasmodium berghei strain ANKA cDNA clone:SG02854... 40 4.7 2 (CV432196) RT0251 Chinese cabbage root library Brassica rapa... 38 4.7 2 (BX629340) Zebrafish DNA sequence from clone DKEY-183O11 in ... 40 4.9 2 (AC186359) Gallus gallus BAC clone CH261-54F21 from chromoso... 44 4.9 1 (AC118684) Mus musculus chromosome 17, clone RP23-414B17, co... 44 4.9 1 (CR962130) Medicago truncatula chromosome 5 clone mte1-63h20... 44 4.9 1 (AC171134) Helobdella robusta clone CH306-1A5, complete sequ... 44 4.9 1 (AC093742) Homo sapiens BAC clone RP11-24M8 from 4, complete... 44 4.9 1 (CU984598) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 44 4.9 1 (CU928595) Pig DNA sequence *** SEQUENCING IN PROGRESS *** f... 44 4.9 1 (EJ229652) 1092402566758 Global-Ocean-Sampling_GS-27-01-01-1... 44 4.9 1 (EI378759) POTBC34TF Solanum tuberosum RHPOTKEY BAC ends Sol... 44 4.9 1 (CZ400620) ZMMBF0182G17f ZMMBF Zea mays genomic clone ZMMBF0... 44 4.9 1 (CR022616) Forward strand read from insert in 5'HPRT inserti... 44 4.9 1 (EE993463) AUF_IpSpn_68_l14 Spleen cDNA library Ictalurus pu... 44 4.9 1 (DV774896) McClintock_45_E03.ab1 Homarus EST library project... 44 4.9 1 (DV774831) McClintock_27_E04.ab1 Homarus EST library project... 44 4.9 1 (DV774529) McClintock43_E05.ab1 Homarus EST library project ... 44 4.9 1 (DV774251) McClintock25_F02.ab1 Homarus EST library project ... 44 4.9 1 (DV017971) CA5F11_T7 Diploptera punctata corpora allata cDNA... 44 4.9 1 (DN790595) 90853947 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN790594) 90985810 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN786707) 90880221 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN784725) 90936513 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN784637) 90141906 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN783084) 90206292 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DN782989) 91003587 Sea Urchin primary mesenchyme cell cDNA ... 44 4.9 1 (DK037057) Oryzias latipes cDNA, clone: olbr42o05, 3' end. 44 4.9 1 (DK025176) Oryzias latipes cDNA, clone: olbr8h22, 3' end. 44 4.9 1 (DC233112) Plasmodium berghei strain ANKA cDNA clone:SG02671... 44 4.9 1 (DC207472) Plasmodium berghei strain ANKA cDNA clone:MG00755... 44 4.9 1 (CX874665) JGI_CAAL11111.fwd NIH_XGC_tropBrn4 Xenopus (Silur... 44 4.9 1 (CX056461) PDUts2002H09 Porcine testis cDNA library II Sus s... 44 4.9 1 (CV967656) PC025E12 infected tomato, center of lesion 3 dpi ... 44 4.9 1 (CV967642) PC025D07 infected tomato, center of lesion 3 dpi ... 44 4.9 1 (CV874008) PDUts1121F11 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV873683) PDUts1117F08 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV871930) PDUts1097A02 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV871326) PDUts1090A10 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV870956) PDUts1085G01 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV869673) PDUts1069H11 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV868128) PDUts1051C03 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV866675) PDUts1033G05 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CV865498) PDUts1018G06 Porcine testis cDNA library I Sus sc... 44 4.9 1 (CT735187) Danio rerio EST, clone ZF_mu_247m11 5'. 44 4.9 1 (CT723479) Danio rerio EST, clone ZF_mu_247d13 5'. 44 4.9 1 (CT698827) Danio rerio EST, clone ZF_mu_201m01 5'. 44 4.9 1 (CT685102) Danio rerio EST, clone ZF_mu_282i07 3'. 44 4.9 1 (CT678162) Danio rerio EST, clone ZF_mu_195d03 3'. 44 4.9 1 (CT656747) Danio rerio EST, clone ZF_mu_143k09 3'. 44 4.9 1 (CT653885) Danio rerio EST, clone ZF_mu_132c21 3'. 44 4.9 1 (CT637813) Danio rerio EST, clone ZF_mu_76p02 3'. 44 4.9 1 (CT632974) Danio rerio EST, clone ZF_mu_92k20 5'. 44 4.9 1 (CT630501) Danio rerio EST, clone ZF_mu_78d16 3'. 44 4.9 1 (CT629463) Danio rerio EST, clone ZF_mu_76m11 3'. 44 4.9 1 (CT628161) Danio rerio EST, clone ZF_mu_63a18 3'. 44 4.9 1 (CT622556) Danio rerio EST, clone ZF_mu_61c20 5'. 44 4.9 1 (CT622444) Danio rerio EST, clone ZF_mu_84c02 5'. 44 4.9 1 (CT583868) Danio rerio EST, clone ZF_mu_47j20 5'. 44 4.9 1 (CO968425) BeE90N19H01 BeE90N Blastocladiella emersonii cDNA... 44 4.9 1 (CJ374287) Molgula tectiformis cDNA, gastrula/neurula clone:... 44 4.9 1 (CJ371706) Molgula tectiformis cDNA, gastrula/neurula clone:... 44 4.9 1 (CJ355639) Molgula tectiformis cDNA, cleaving embryo clone:m... 44 4.9 1 (CI999303) Marsupenaeus japonicus cDNA, clone:YAQ02A01NGRM00... 44 4.9 1 (AL042866) Homo sapiens mRNA; EST DKFZp434H0522_r1 (from cl... 44 4.9 1 (CF874669) tric007xb17.b11 T.reesei mycelial culture, Versio... 44 4.9 1 (CF873291) tric005xk10.b11 T.reesei mycelial culture, Versio... 44 4.9 1 (CF873160) tric004xj19.b11 T.reesei mycelial culture, Versio... 44 4.9 1 (CF605928) RADIC01_001720 Grape Root pSPORT1 Library Vitis v... 44 4.9 1 (CF605729) RADIC01_001468 Grape Root pSPORT1 Library Vitis v... 44 4.9 1 (CF338183) JMT--08-P01.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF338147) JMT--08-O06.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF338082) JMT--08-M18.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF338032) JMT--08-L14.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337976) JMT--08-K08.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337972) JMT--08-K06.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337904) JMT--08-I18.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337838) JMT--08-H06.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337764) JMT--08-F14.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337687) JMT--08-D22.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF337587) JMT--08-B15.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CF334355) JMT--03-J23.b1 AtJMT-overexpressing transgenic ri... 44 4.9 1 (CD203443) Ls_AM1_08F07_T7 Litomosoides sigmodontis adult ma... 44 4.9 1 (CA301199) SCCCLV1C04H07.g LV1 Saccharum officinarum cDNA cl... 44 4.9 1 (CA183203) SCQGST3122C03.g ST3 Saccharum officinarum cDNA cl... 44 4.9 1 (BP507368) Hydra magnipapillata cDNA, clone:hmp_00773. 44 4.9 1 (BJ748697) Oryzias latipes cDNA clone:MF015DA034c10, 3' end. 44 4.9 1 (BJ541908) Oryzias latipes cDNA clone:MF01SSB036E18, 3' end ... 44 4.9 1 (BI343418) 371561 MARC 2PIG Sus scrofa cDNA 5', mRNA sequence. 44 4.9 1 (BB977912) Plasmodium berghei str. ANKA cDNA clone: OK007911... 44 4.9 1 (BB975750) Plasmodium berghei str. ANKA cDNA clone: OK005598... 44 4.9 1 (BB975679) Plasmodium berghei str. ANKA cDNA clone: OK005523... 44 4.9 1 (BB975498) Plasmodium berghei str. ANKA cDNA clone: OK005330... 44 4.9 1 (BB975197) Plasmodium berghei str. ANKA cDNA clone: OK005019... 44 4.9 1 (BB974453) Plasmodium berghei str. ANKA cDNA clone: OK004259... 44 4.9 1 (BB974323) Plasmodium berghei str. ANKA cDNA clone: OK004125... 44 4.9 1 (BB973811) Plasmodium berghei str. ANKA cDNA clone: OK003598... 44 4.9 1 (BB973508) Plasmodium berghei str. ANKA cDNA clone: OK003290... 44 4.9 1 (BB973241) Plasmodium berghei str. ANKA cDNA clone: OK003016... 44 4.9 1 (BB973105) Plasmodium berghei str. ANKA cDNA clone: OK002839... 44 4.9 1 (FG631545) TOBESTR120C12 TOBEST cDNA library 1 Nicotiana tab... 44 4.9 1 (FG629160) TOBESTR092H02 TOBEST cDNA library 1 Nicotiana tab... 44 4.9 1 (FD873309) CBHO17116.fwd CBHO Volvox carteri f. nagariensis ... 44 4.9 1 (FC755364) CBBI8671.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 4.9 1 (EY887685) TS27-C2-300-019-H07-CT.F Sunki mandarin bark, gre... 44 4.9 1 (EY878470) LT33-C1-003-029-A05-CT.F Tahiti lime leaf, greenh... 44 4.9 1 (EY878013) CL06-C4-501-074-C01-CT.F Rangpur lime root, plant... 44 4.9 1 (EY876607) CL06-C4-501-055-B02-CT.F Rangpur lime root, plant... 44 4.9 1 (EY876249) CL06-C4-501-048-H03-CT.F Rangpur lime root, plant... 44 4.9 1 (EY869472) CL06-C4-500-028-H11-CT.F Rangpur lime root, green... 44 4.9 1 (EY848649) CA26-C1-002-082-A05-CT.F Sour orange leaf, field ... 44 4.9 1 (EY841189) PT11-C9-005-036-F05-CT.F Poncirus trifoliata seed... 44 4.9 1 (EY824494) PT11-C1-901-066-G06-CT.F Poncirus trifoliata leaf... 44 4.9 1 (EY824086) PT11-C1-901-060-B05-CT.F Poncirus trifoliata leaf... 44 4.9 1 (EY817495) PT11-C1-900-088-B05-CT.F Poncirus trifoliata leaf... 44 4.9 1 (EY816300) PT11-C1-900-068-F11-CT.F Poncirus trifoliata leaf... 44 4.9 1 (EY800818) CR05-C3-701-043-G03-CT.F Mandarin fruit, developm... 44 4.9 1 (EY798722) CR05-C3-701-067-H11-CT.F Mandarin fruit, developm... 44 4.9 1 (EY798485) CR05-C3-701-066-C09-CT.F Mandarin fruit, developm... 44 4.9 1 (EY797315) CR05-C3-701-051-B04-CT.F Mandarin fruit, developm... 44 4.9 1 (EY794574) CR05-C3-701-021-E11-CT.F Mandarin fruit, developm... 44 4.9 1 (EY793947) CR05-C3-701-012-D12-CT.F Mandarin fruit, developm... 44 4.9 1 (EY793507) CR05-C3-701-007-E01-CT.F Mandarin fruit, developm... 44 4.9 1 (EY793492) CR05-C3-701-007-C10-CT.F Mandarin fruit, developm... 44 4.9 1 (EY782253) CR05-C1-103-087-H06-CT.F Mandarin leaf, infected ... 44 4.9 1 (EY782076) CR05-C1-103-085-G01-CT.F Mandarin leaf, infected ... 44 4.9 1 (EY780439) CR05-C1-103-070-H05-CT.F Mandarin leaf, infected ... 44 4.9 1 (EY779497) CR05-C1-103-052-B12-CT.F Mandarin leaf, infected ... 44 4.9 1 (EY753159) CS00-C5-003-055-F07-CT.F Sweet orange flower, gre... 44 4.9 1 (EY742958) CS00-C3-705-097-D09-CT.F Sweet orange fruit, deve... 44 4.9 1 (EY725961) CS00-C3-703-042-E09-CT.F Sweet orange fruit, deve... 44 4.9 1 (EY710709) CS00-C3-701-086-C10-CT.F Sweet orange fruit, deve... 44 4.9 1 (EY710257) CS00-C3-701-091-G07-CT.F Sweet orange fruit, deve... 44 4.9 1 (EY698735) CS00-C3-700-075-C03-CT.F Sweet orange fruit, deve... 44 4.9 1 (EY679553) CS00-C1-401-052-E03-CT.F Sweet orange leaf, infec... 44 4.9 1 (EY675828) CS00-C1-401-015-E09-CT.F Sweet orange leaf, infec... 44 4.9 1 (EY667094) CS00-C1-102-028-B01-CT.F Sweet orange leaf, infec... 44 4.9 1 (EY658496) CS00-C1-100-128-A08-CT.F Sweet orange leaf, green... 44 4.9 1 (EY657815) CS00-C1-100-136-D06-CT.F Sweet orange leaf, green... 44 4.9 1 (EY657665) CS00-C1-100-126-F03-CT.F Sweet orange leaf, green... 44 4.9 1 (EX833338) CBNB3949.fwd CBNB Phycomyces blakesleeanus NRRL15... 44 4.9 1 (EV225248) 0107174 Brassica napus Damaged cotyledons Brassic... 44 4.9 1 (EV203231) 0104384 Brassica napus Cold acclimation - light B... 44 4.9 1 (EV193736) 0091221 Brassica napus Cold acclimation - dark Br... 44 4.9 1 (EV192837) 0090319 Brassica napus Cold acclimation - dark Br... 44 4.9 1 (EV191492) 0088973 Brassica napus Cold acclimation - dark Br... 44 4.9 1 (EV141434) 0207365 Brassica napus Very early anther Brassica... 44 4.9 1 (EV139697) 0205623 Brassica napus Very early anther Brassica... 44 4.9 1 (EV103988) 0095680 Brassica napus Leaf library Brassica napu... 44 4.9 1 (EV102982) 0095305 Brassica napus Leaf library Brassica napu... 44 4.9 1 (FI422170) CH322-152E17.y CHORI-322 Drosophila melanogaster ... 38 5.1 2 (BB975668) Plasmodium berghei str. ANKA cDNA clone: OK005511... 40 5.2 2 (BB973235) Plasmodium berghei str. ANKA cDNA clone: OK003010... 40 5.2 2 (BP507338) Hydra magnipapillata cDNA, clone:hmp_00494. 40 5.3 2 (BB973032) Plasmodium berghei str. ANKA cDNA clone: OK002765... 38 5.3 2 (CV432224) RT0297 Chinese cabbage root library Brassica rapa... 38 5.4 2 (AC162031) Medicago truncatula chromosome 8 clone mth2-194a2... 36 5.6 3 (BB972923) Plasmodium berghei str. ANKA cDNA clone: OK002652... 40 5.7 2 (CV876185) PDUts1148H05 Porcine testis cDNA library I Sus sc... 40 5.8 2 (CV867294) PDUts1041C07 Porcine testis cDNA library I Sus sc... 38 5.9 2 (CR790374) Zebrafish DNA sequence *** SEQUENCING IN PROGRESS... 34 5.9 4 (AC188579) Gallus gallus BAC clone CH261-132G22 from chromos... 38 6.0 5 (FE233321) CAPG2223.fwd CAPG Naegleria gruberi amoeba stage ... 32 6.0 3 (CJ351626) Molgula tectiformis cDNA, cleaving embryo clone:m... 38 6.1 2 (CA502264) WHE4045_A11_A21ZT Wheat meiotic anther cDNA libra... 38 6.1 2 (AC229830) Monodelphis domestica clone VMRC18-620L2, WORKING... 36 6.1 3 (CJ352137) Molgula tectiformis cDNA, cleaving embryo clone:m... 40 6.2 2 (AC146681) Medicago truncatula clone mth2-77o10, complete se... 34 6.3 5 (DC230659) Plasmodium berghei strain ANKA cDNA clone:SG01935... 40 6.4 2 (EJ778062) 1093011121072 Global-Ocean-Sampling_GS-30-02-01-1... 36 6.5 2 (CJ354393) Molgula tectiformis cDNA, cleaving embryo clone:m... 38 6.5 2 (ES429956) Plate_23b_G10 Hibernating 13-lined squirrel brain... 38 6.6 2 (CT614707) Danio rerio EST, clone ZF_mu_79l18 3'. 40 6.6 2 (FH348998) CHO_OF4653xc01f1.ab1 CHO_OF4 Nicotiana tabacum ge... 36 6.6 2 (CT726931) Danio rerio EST, clone ZF_mu_236k07 3'. 40 6.7 2 (EV104819) 0110131 Brassica napus Senescent leaves Brassica ... 40 6.7 2 (AC111282) Rattus norvegicus clone CH230-53L17, *** SEQUENCI... 36 6.8 4 (EK072719) 1092961004807 Global-Ocean-Sampling_GS-31-01-01-1... 38 6.9 2 (FC834925) CBHI5850.fwd CBHI Metridium senile tentacle Metri... 34 7.0 2 (BG784964) SEAUMC004921 Sea urchin primary mesenchyme cell c... 40 7.1 2 (BG786233) SEAUMC006190 Sea urchin primary mesenchyme cell c... 40 7.3 2 (FC836257) CBHI6568.fwd CBHI Metridium senile tentacle Metri... 34 7.5 2 (CT715288) Danio rerio EST, clone ZF_mu_267b14 5'. 40 7.5 2 (CT665188) Danio rerio EST, clone ZF_mu_142f21 3'. 40 7.6 2 (AC224322) Bos taurus clone CH240-489B23, WORKING DRAFT SEQU... 36 7.6 4 (CT628007) Danio rerio EST, clone ZF_mu_90f16 5'. 38 7.6 2 (CJ982932) Bursaphelenchus xylophilus cDNA clone: Bx_K1_49G1... 36 7.8 2 (EY826271) PT11-C1-901-073-F01-CT.F Poncirus trifoliata leaf... 38 7.8 2 (DN786366) 90167298 Sea Urchin primary mesenchyme cell cDNA ... 38 7.9 2 (EJ764932) 1092963190726 Global-Ocean-Sampling_GS-30-02-01-1... 36 7.9 2 (EY783055) CR05-C1-103-096-H10-CT.F Mandarin leaf, infected ... 38 8.0 2 (CV966713) PC011G02 infected tomato, center of lesion 3 dpi ... 40 8.0 2 (CT600547) Danio rerio EST, clone ZF_mu_89i05 3'. 36 8.0 2 (EY679069) CS00-C1-401-054-G12-CT.F Sweet orange leaf, infec... 40 8.0 2 (EY673918) CS00-C1-102-004-G01-CT.F Sweet orange leaf, infec... 38 8.4 2 (DN792017) 90881534 Sea Urchin primary mesenchyme cell cDNA ... 40 8.4 2 (EY774070) CR05-C1-102-088-A04-CT.F Mandarin leaf, infected ... 40 8.4 2 (EY852522) CG32-C1-003-023-C02-CT.F Mexican lime leaf, green... 38 8.4 2 (DN788184) 90954358 Sea Urchin primary mesenchyme cell cDNA ... 40 8.5 2 (DN784816) 91035595 Sea Urchin primary mesenchyme cell cDNA ... 38 8.5 2 (CK417034) AUF_IpInt_55_e16 Intestine cDNA library Ictalurus... 40 8.5 2 (CU861893) Zebrafish DNA sequence from clone CH73-168D12. 42 8.5 2 (DN783561) 90258709 Sea Urchin primary mesenchyme cell cDNA ... 38 8.6 2 (DN782115) 90162144 Sea Urchin primary mesenchyme cell cDNA ... 40 8.7 2 (DN783115) 90185310 Sea Urchin primary mesenchyme cell cDNA ... 38 8.7 2 (DN782670) 90196218 Sea Urchin primary mesenchyme cell cDNA ... 38 8.7 2 (DV018118) CA7H09_T7 Diploptera punctata corpora allata cDNA... 40 8.7 2 (EY710438) CS00-C3-701-115-C01-CT.F Sweet orange fruit, deve... 40 8.8 2 (AC131301) Mus musculus chromosome 14, clone RP24-70B5, comp... 30 8.8 2 (DN790843) 90871740 Sea Urchin primary mesenchyme cell cDNA ... 40 8.8 2 (DN565886) 90962201 Sea Urchin primary mesenchyme cell cDNA ... 36 8.8 2 (AC107670) Mus musculus chromosome 14, clone RP23-54K15, com... 30 8.9 2 (DV018022) CA6E03_T7 Diploptera punctata corpora allata cDNA... 40 9.0 2 (DN791880) 90187884 Sea Urchin primary mesenchyme cell cDNA ... 40 9.1 2 (BB979690) Plasmodium berghei str. ANKA cDNA clone: OK009794... 38 9.4 2 (EY657718) CS00-C1-100-095-C01-CT.F Sweet orange leaf, green... 40 9.4 2 (EY743939) CS00-C3-705-104-G10-CT.F Sweet orange fruit, deve... 40 9.4 2 (EY789106) CR05-C3-700-029-G09-CT.F Mandarin fruit, developm... 38 9.6 2 (EY816469) PT11-C1-900-077-F12-CT.F Poncirus trifoliata leaf... 38 9.6 2
>(AU269026) Dictyostelium discoideum vegetative cDNA clone:VSI651, 5' end single read. Length = 453
Score = 805 bits (406), Expect = 0.0 Identities = 406/406 (100%) Strand = Plus / Plus
Query: 1 cccccctcgggtcgaccccgcgtccgataataaaatggcatcaaaacttggatttgttca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 cccccctcgggtcgaccccgcgtccgataataaaatggcatcaaaacttggatttgttca 60
Query: 61 tcaagctacacaaaatgttttatttaaacaaccacgtttctatttagaggcttcatcaaa 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 tcaagctacacaaaatgttttatttaaacaaccacgtttctatttagaggcttcatcaaa 120
Query: 121 aggtcaatttgctgattcaattgttgatttgtcaggtattcaacgttggaataatgatag 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 aggtcaatttgctgattcaattgttgatttgtcaggtattcaacgttggaataatgatag 180
Query: 181 aagtaaaataggtaatcaattttcaaatagattcgttaaaccatcacgtgttaaattttt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 aagtaaaataggtaatcaattttcaaatagattcgttaaaccatcacgtgttaaattttt 240
Query: 241 aagaaagaaacaagttcaaaaatataaatgggatcactttgtttatgatgtttgtaaaaa 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 aagaaagaaacaagttcaaaaatataaatgggatcactttgtttatgatgtttgtaaaaa 300
Query: 301 ttatgaatttattagagaaaatgcaagagaaatttcaagagaaccaaacagattagcaaa 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 ttatgaatttattagagaaaatgcaagagaaatttcaagagaaccaaacagattagcaaa 360
Query: 361 aattgaaagagcaaattcatggttaggtgattatcatcaataaccc 406 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 aattgaaagagcaaattcatggttaggtgattatcatcaataaccc 406
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 105743758 Number of Hits to DB: 623,786,929 Number of extensions: 39208271 Number of successful extensions: 3296159 Number of sequences better than 10.0: 406 Length of query: 480 Length of database: 104,622,809,269 Length adjustment: 23 Effective length of query: 457 Effective length of database: 102,190,702,835 Effective search space: 46701151195595 Effective search space used: 46701151195595 X1: 11 (21.8 bits) S2: 21 (42.1 bits)
|