Homology vs DNA |
Query= Contig-U04316-1 (Contig-U04316-1Q) /CSM_Contig/Contig-U04316-1Q.Seq.d (520 letters)
Database: ddbj_A 102,105,510 sequences; 101,790,757,118 total letters
Searching..................................................done
Score E Sequences producing significant alignments: (bits) Value N
(AU075930) Dictyostelium discoideum slug cDNA, clone SSA140. 700 0.0 3 (C24640) Dictyostelium discoideum slug cDNA, clone SL-X040. 696 0.0 3 (AU051920) Dictyostelium discoideum slug cDNA, clone SSC401. 702 0.0 2 (AY280458) Dictyostelium discoideum MyoD light chain (mlcD) ... 539 0.0 4 (AU268216) Dictyostelium discoideum vegetative cDNA clone:VS... 581 e-161 1 (AU268217) Dictyostelium discoideum vegetative cDNA clone:VS... 557 e-154 1 (AU073512) Dictyostelium discoideum slug cDNA, clone SSH417. 96 7e-39 3 (FC671841) CAXW8404.rev CAXW Lottia gigantea from female gon... 44 4e-07 2 (FC742243) CBBI12957.rev CBBI Lottia gigantea 26h,37h,61h La... 48 6e-06 2 (FC672659) CAXW8950.fwd CAXW Lottia gigantea from female gon... 44 9e-05 2 (FC728863) CBBG503.rev CBBG Lottia gigantea 12,15,18h embryo... 44 9e-05 2 (FC643224) CAXU6451.fwd CAXU Lottia gigantea from female gon... 44 9e-05 2 (FC770008) CBBN543.fwd CBBN Lottia gigantea 3,4,5,6.5d Larva... 44 9e-05 2 (FC609339) CAXS4396.fwd CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC611061) CAXS5342.fwd CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC802335) CBGC5017.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC752087) CBBI6164.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC638390) CAXU3181.fwd CAXU Lottia gigantea from female gon... 44 9e-05 2 (FC806644) CBGC8027.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC619778) CAXT1018.rev CAXT Lottia gigantea from mantle Lot... 44 9e-05 2 (FC756072) CBBI9140.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC717807) CBBG11734.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC717639) CBBG11630.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC728864) CBBG503.fwd CBBG Lottia gigantea 12,15,18h embryo... 44 9e-05 2 (FC786562) CBGC16483.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC780952) CBGC1277.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC804514) CBGC652.fwd CBGC Lottia gigantea 15h 18h embryos ... 44 9e-05 2 (FC717184) CBBG11333.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC788936) CBGC19397.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC724127) CBBG1932.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC735416) CBBG9647.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC720569) CBBG13503.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC631001) CAXT7425.fwd CAXT Lottia gigantea from mantle Lot... 44 9e-05 2 (FC745812) CBBI1692.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC797150) CBGC2462.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC787557) CBGC17814.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC643223) CAXU6451.rev CAXU Lottia gigantea from female gon... 44 9e-05 2 (FC779013) CBGC11523.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC734674) CBBG9138.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC619779) CAXT1018.fwd CAXT Lottia gigantea from mantle Lot... 44 9e-05 2 (FC723991) CBBG1833.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC784060) CBGC14735.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC757225) CBBI9908.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC757224) CBBI9908.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC756940) CBBI9721.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC753373) CBBI7320.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC725332) CBBG2756.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC783049) CBGC14094.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC782746) CBGC13902.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC755199) CBBI8562.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC755071) CBBI8466.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC790359) CBGC20292.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC720893) CBBG13705.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC781116) CBGC12875.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC722089) CBBG14453.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC750337) CBBI5071.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC724126) CBBG1932.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC722040) CBBG14422.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC606599) CAXS2797.fwd CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC802250) CBGC4955.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC715270) CBBG10017.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC732724) CBBG7432.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC720568) CBBG13503.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC789280) CBGC19616.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC735447) CBBG9671.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC708826) CAXY5446.fwd CAXY Lottia gigantea from male gonad... 44 9e-05 2 (FC786561) CBGC16483.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC718093) CBBG11912.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC602088) CAXS1390.fwd CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC786217) CBGC16265.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC729794) CBBG5601.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC717806) CBBG11734.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC725510) CBBG2870.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC790539) CBGC2041.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC786524) CBGC16461.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC786523) CBGC16461.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC786476) CBGC16432.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC791276) CBGC20877.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC780083) CBGC12228.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC747346) CBBI3149.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC783471) CBGC14371.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC747345) CBBI3149.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC672658) CAXW8950.rev CAXW Lottia gigantea from female gon... 44 9e-05 2 (FC632204) CAXT8059.fwd CAXT Lottia gigantea from mantle Lot... 44 9e-05 2 (FC786218) CBGC16265.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC782745) CBGC13902.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC725232) CBBG2689.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC718069) CBBG11899.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC732433) CBBG7256.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC720892) CBBG13705.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC800008) CBGC3347.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC784047) CBGC14727.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC754789) CBBI8268.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC746095) CBBI1889.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC788935) CBGC19397.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC756071) CBBI9140.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC752086) CBBI6164.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC750806) CBBI5368.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC715269) CBBG10017.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC786380) CBGC16368.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC779012) CBGC11523.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC752177) CBBI6216.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC744098) CBBI14090.rev CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC721142) CBBG13852.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC798486) CBGC25451.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC782832) CBGC13962.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC716151) CBBG10622.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC792670) CBGC21774.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC787083) CBGC1716.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC753372) CBBI7320.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC750867) CBBI5404.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC723990) CBBG1833.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC719285) CBBG1268.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC806324) CBGC7777.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC801743) CBGC4613.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC786489) CBGC16440.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC746094) CBBI1889.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC719286) CBBG1268.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC798964) CBGC2585.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC779327) CBGC11728.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC750866) CBBI5404.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC732723) CBBG7432.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC751015) CBBI5495.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC742244) CBBI12957.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC721143) CBBG13852.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC805456) CBGC7143.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC790008) CBGC2007.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC786477) CBGC16432.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC784802) CBGC15394.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC783006) CBGC14067.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC756379) CBBI9342.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC794676) CBGC23070.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC778616) CBGC11259.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC716150) CBBG10622.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC792075) CBGC21390.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC729204) CBBG5251.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC731596) CBBG6736.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC718092) CBBG11912.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC782831) CBGC13962.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC787760) CBGC17951.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC729793) CBBG5601.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC725331) CBBG2756.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC725895) CBBG3137.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC795393) CBGC23517.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC795376) CBGC23505.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC795524) CBGC23603.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC729203) CBBG5251.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC638389) CAXU3181.rev CAXU Lottia gigantea from female gon... 44 9e-05 2 (FC799314) CBGC2840.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC746143) CBBI1917.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC800007) CBGC3347.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC799321) CBGC2848.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC791495) CBGC21019.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC746144) CBBI1917.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC726215) CBBG3356.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC798499) CBGC25458.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC719817) CBBG13008.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC742841) CBBI13321.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC807430) CBGC8981.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC732432) CBBG7256.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC717638) CBBG11630.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC799151) CBGC2722.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC791070) CBGC20749.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC788564) CBGC18812.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC806772) CBGC8503.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC784280) CBGC14871.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC783241) CBGC14225.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC731571) CBBG6720.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC806323) CBGC7777.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC719363) CBBG12728.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC805218) CBGC6986.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC783813) CBGC14583.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC752176) CBBI6216.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC750338) CBBI5071.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC739873) CBBI11483.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC802154) CBGC4884.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC745811) CBBI1692.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC793466) CBGC22282.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC741232) CBBI12350.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC807410) CBGC8966.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC722039) CBBG14422.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC807653) CBGC9134.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC725509) CBBG2870.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC807457) CBGC8998.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC795682) CBGC23707.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC788065) CBGC18508.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC732546) CBBG7326.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC802153) CBGC4884.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC793973) CBGC22621.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC732545) CBBG7326.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC726721) CBBG3704.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC725231) CBBG2689.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC801016) CBGC4109.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC783812) CBGC14583.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC781615) CBGC13198.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC723747) CBBG1666.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC723746) CBBG1666.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC802015) CBGC4794.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC741367) CBBI12426.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC655246) CAXW14105.fwd CAXW Lottia gigantea from female go... 44 9e-05 2 (FC787759) CBGC17951.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC779326) CBGC11728.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC740573) CBBI1192.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC799540) CBGC3016.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC777301) CBGC10311.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC716487) CBBG10852.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC716486) CBBG10852.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC717183) CBBG11333.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC807429) CBGC8981.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC784801) CBGC15394.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC782311) CBGC13631.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC756378) CBBI9342.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC739872) CBBI11483.rev CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC794146) CBGC22720.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC726214) CBBG3356.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC726914) CBBG3831.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC721938) CBBG14367.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC799978) CBGC3327.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC794145) CBGC22720.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC741366) CBBI12426.rev CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC807456) CBGC8998.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC802014) CBGC4794.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC788066) CBGC18508.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC602087) CAXS1390.rev CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC755198) CBBI8562.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC800145) CBGC3452.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC606598) CAXS2797.rev CAXS Lottia gigantea from head, foot... 44 9e-05 2 (FC805217) CBGC6986.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC735276) CBBG9552.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC792174) CBGC2145.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC737105) CBBH2059.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC781117) CBGC12875.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC726913) CBBG3831.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC801465) CBGC4416.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC734673) CBBG9138.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC656364) CAXW14750.fwd CAXW Lottia gigantea from female go... 44 9e-05 2 (FC739218) CBBI11047.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC798500) CBGC25458.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC783472) CBGC14371.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC791069) CBGC20749.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC795833) CBGC23814.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC660504) CAXW17760.fwd CAXW Lottia gigantea from female go... 44 9e-05 2 (FC567736) CAWF7308.fwd CAWF Lottia gigantea from mantle (H)... 44 9e-05 2 (FC803530) CBGC5839.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC781712) CBGC13254.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC781038) CBGC12828.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC781037) CBGC12828.rev CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC722552) CBBG14755.fwd CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC744745) CBBI14485.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC748410) CBBI3903.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC748717) CBBI4094.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC806643) CBGC8027.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC748704) CBBI4083.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC744099) CBBI14090.fwd CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC734805) CBBG9226.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC734804) CBBG9226.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC799977) CBGC3327.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC721937) CBBG14367.rev CBBG Lottia gigantea 12,15,18h embr... 44 9e-05 2 (FC748716) CBBI4094.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC743230) CBBI1356.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC725968) CBBG3189.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC744744) CBBI14485.rev CBBI Lottia gigantea 26h,37h,61h La... 44 9e-05 2 (FC735446) CBBG9671.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC808650) CBGC9805.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC756813) CBBI9632.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 44 9e-05 2 (FC732894) CBBG7542.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC777302) CBGC10311.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC806314) CBGC7768.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC783007) CBGC14067.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC799313) CBGC2840.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC806313) CBGC7768.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC600300) CAXS12803.fwd CAXS Lottia gigantea from head, foo... 44 9e-05 2 (FC731062) CBBG6393.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC731061) CBBG6393.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC725142) CBBG2628.fwd CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC783456) CBGC14361.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC562704) CAWF4573.fwd CAWF Lottia gigantea from mantle (H)... 44 9e-05 2 (FC732893) CBBG7542.rev CBBG Lottia gigantea 12,15,18h embry... 44 9e-05 2 (FC791545) CBGC2105.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC791544) CBGC2105.rev CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (FC794677) CBGC23070.fwd CBGC Lottia gigantea 15h 18h embryo... 44 9e-05 2 (FC669123) CAXW6814.fwd CAXW Lottia gigantea from female gon... 44 9e-05 2 (FC671842) CAXW8404.fwd CAXW Lottia gigantea from female gon... 44 9e-05 2 (FC806222) CBGC7693.fwd CBGC Lottia gigantea 15h 18h embryos... 44 9e-05 2 (AM761799) Oopsacas minuta EST, 5' end sequence, clone IL0AF... 56 0.001 1 (FC743229) CBBI1356.rev CBBI Lottia gigantea 26h,37h,61h Lar... 44 0.005 2 (FC801055) CBGC4143.rev CBGC Lottia gigantea 15h 18h embryos... 38 0.005 2 (FC656363) CAXW14750.rev CAXW Lottia gigantea from female go... 44 0.005 2 (FC664903) CAXW408.fwd CAXW Lottia gigantea from female gona... 44 0.005 2 (FC664902) CAXW408.rev CAXW Lottia gigantea from female gona... 44 0.005 2 (FC562703) CAWF4573.rev CAWF Lottia gigantea from mantle (H)... 44 0.005 2 (DY448462) HSAA-aaa41h02.g1 UCI-11 Hydra vulgaris cDNA 5' si... 54 0.005 1 (DY447596) HSAA-aaa24g10.g1 UCI-11 Hydra vulgaris cDNA 5' si... 54 0.005 1 (CN564863) tag20d11.y1 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 0.005 1 (CN564624) tag20d11.x1 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 0.005 1 (CN561176) taf79d08.y2 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 0.005 1 (CK593460) tad34h12.y2 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 54 0.005 1 (CP001185) Thermosipho africanus TCF52B, complete genome. 54 0.005 1 (FC753310) CBBI708.fwd CBBI Lottia gigantea 26h,37h,61h Larv... 36 0.018 2 (FC726967) CBBG3869.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC787335) CBGC1765.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC800964) CBGC4071.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC753309) CBBI708.rev CBBI Lottia gigantea 26h,37h,61h Larv... 36 0.018 2 (FC726968) CBBG3869.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC795417) CBGC23532.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC795299) CBGC23447.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC720251) CBBG1330.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC795416) CBGC23532.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC790197) CBGC20193.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC805291) CBGC7037.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC751711) CBBI5941.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC718922) CBBG1245.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC792502) CBGC21663.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC782930) CBGC14023.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC799312) CBGC2839.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC737937) CBBH2725.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC733635) CBBG8052.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC787334) CBGC1765.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC749962) CBBI4836.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC725932) CBBG3161.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC780212) CBGC12310.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC751165) CBBI5583.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC805290) CBGC7037.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC778157) CBGC10940.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC750972) CBBI5469.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC749853) CBBI477.fwd CBBI Lottia gigantea 26h,37h,61h Larv... 36 0.018 2 (FC747293) CBBI3104.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC798333) CBGC25357.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC732023) CBBG7001.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC802270) CBGC4969.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC799787) CBGC3189.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC731368) CBBG6593.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC805887) CBGC7455.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC725931) CBBG3161.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC750971) CBBI5469.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC778634) CBGC11272.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC756939) CBBI9721.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC799230) CBGC2784.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC794490) CBGC22948.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC731367) CBBG6593.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC801015) CBGC4109.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC733458) CBBG7917.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC808573) CBGC9750.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC789784) CBGC19922.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC789783) CBGC19922.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC801056) CBGC4143.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC794489) CBGC22948.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC788962) CBGC19411.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC788961) CBGC19411.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC777023) CBGC10120.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC749852) CBBI477.rev CBBI Lottia gigantea 26h,37h,61h Larv... 36 0.018 2 (FC807236) CBGC8837.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC805325) CBGC7062.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC800172) CBGC3472.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC800171) CBGC3472.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC800092) CBGC3414.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC777022) CBGC10120.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC796175) CBGC24023.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC752230) CBBI6249.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC721911) CBBG14349.fwd CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC721910) CBBG14349.rev CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC795529) CBGC23607.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC754781) CBBI8257.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC783726) CBGC14524.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC756679) CBBI9534.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC756678) CBBI9534.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC806485) CBGC7910.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC804573) CBGC656.fwd CBGC Lottia gigantea 15h 18h embryos ... 36 0.018 2 (FC803308) CBGC5689.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC803307) CBGC5689.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC797058) CBGC24569.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC791256) CBGC20864.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC787486) CBGC17763.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC787485) CBGC17763.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC796147) CBGC24001.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC796146) CBGC24001.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC785976) CBGC16114.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC733499) CBBG7947.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC733498) CBBG7947.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC804282) CBGC6365.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC803178) CBGC5603.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC803177) CBGC5603.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC799231) CBGC2784.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC796251) CBGC24068.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC787561) CBGC17816.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC787560) CBGC17816.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC782492) CBGC13747.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC779884) CBGC12095.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC778633) CBGC11272.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC754780) CBBI8257.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC733634) CBBG8052.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC723767) CBBG1679.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC723766) CBBG1679.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC722496) CBBG14721.fwd CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC722495) CBBG14721.rev CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC720247) CBBG13298.fwd CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC720246) CBBG13298.rev CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC808572) CBGC9750.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC782493) CBGC13747.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC778482) CBGC11162.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC777291) CBGC10306.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC732265) CBBG7160.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC732264) CBBG7160.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC780666) CBGC12588.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC793142) CBGC22074.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC776762) CBGB701.fwd CBGB Lottia gigantea 3,6,9,12h embryo... 36 0.018 2 (FC793143) CBGC22074.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC747248) CBBI3070.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC797832) CBGC25044.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC785975) CBGC16114.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC783703) CBGC14508.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC725198) CBBG2667.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC806484) CBGC7910.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC788062) CBGC18506.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC791255) CBGC20864.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC803529) CBGC5839.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC792501) CBGC21663.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC804955) CBGC6810.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC797831) CBGC25044.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC779883) CBGC12095.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC747247) CBBI3070.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC744513) CBBI1435.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC783855) CBGC1461.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC783854) CBGC1461.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC720250) CBBG1330.rev CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC804492) CBGC6505.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC781546) CBGC13151.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC757083) CBBI9824.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC804491) CBGC6505.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC805324) CBGC7062.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC791564) CBGC21063.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC750312) CBBI5051.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC778926) CBGC11463.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC802535) CBGC5153.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC747292) CBBI3104.rev CBBI Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC808939) CBGC9998.fwd CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC798413) CBGC25405.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC717961) CBBG11822.fwd CBBG Lottia gigantea 12,15,18h embr... 36 0.018 2 (FC783727) CBGC14524.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC737936) CBBH2725.rev CBBH Lottia gigantea 26h,37h,61h Lar... 36 0.018 2 (FC785748) CBGC15978.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC735279) CBBG9554.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC783455) CBGC14361.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC802534) CBGC5153.rev CBGC Lottia gigantea 15h 18h embryos... 36 0.018 2 (FC729196) CBBG5247.fwd CBBG Lottia gigantea 12,15,18h embry... 36 0.018 2 (FC777292) CBGC10306.fwd CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (FC798332) CBGC25357.rev CBGC Lottia gigantea 15h 18h embryo... 36 0.018 2 (DR945176) EST1136715 Aquilegia cDNA library Aquilegia formo... 52 0.021 1 (FC655245) CAXW14105.rev CAXW Lottia gigantea from female go... 52 0.021 1 (DQ336955) Glycine max cultivar Williams 82 clone BAC gmw1-5... 38 0.025 4 (AC108162) Homo sapiens BAC clone RP11-686G17 from 4, comple... 38 0.026 5 (AC106117) Rattus norvegicus clone CH230-52K20, *** SEQUENCI... 40 0.077 4 (FJ265022) Homaloptera leonardi growth hormone (GH) gene, pa... 50 0.085 1 (CT009602) PTB-121B21, complete sequence. 50 0.085 1 (AC194764) Pan troglodytes BAC clone CH251-432O16 from chrom... 50 0.085 1 (AC004409) Homo Sapiens Chromosome X clone bWXD178, complete... 50 0.085 1 (AZ757516) ew09c07.r1 PAX3/FKHR CASTing Library 'ew' Homo sa... 50 0.085 1 (EH114941) G06_RPL_P22 Fifth instar salivary gland cDNA libr... 50 0.085 1 (EH114690) E04_RPL_P25 Fifth instar salivary gland cDNA libr... 50 0.085 1 (CN568996) tad33a01.x1 Hydra EST -Kiel 1 Hydra vulgaris cDNA... 50 0.085 1 (FG547588) NADI-aaa61h05.g2 Rhodnius_prolixus_EST_NADI_5th_i... 50 0.085 1 (FG543845) NADI-aaa57e01.b2 Rhodnius_prolixus_EST_NADI_5th_i... 50 0.085 1 (FG543612) NADI-aaa98b12.b1 Rhodnius_prolixus_EST_NADI_5th_i... 50 0.085 1 (FD480813) NADI-aaa35b11.g1 Rhodnius_prolixus_EST_NADI_5th_i... 50 0.085 1 (FC762877) CBBN13563.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.13 2 (FC738170) CBBH2932.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 42 0.13 2 (FC580550) CAXP14592.fwd CAXP Lottia gigantea from head, foo... 42 0.14 2 (FC747075) CBBI2937.fwd CBBI Lottia gigantea 26h,37h,61h Lar... 42 0.14 2 (FC573569) CAXP10570.fwd CAXP Lottia gigantea from head, foo... 42 0.14 2 (FC743076) CBBI13459.fwd CBBI Lottia gigantea 26h,37h,61h La... 42 0.14 2 (FC769338) CBBN4993.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.14 2 (FC759285) CBBN11326.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.14 2 (FC580298) CAXP14454.fwd CAXP Lottia gigantea from head, foo... 42 0.14 2 (FC579863) CAXP14203.fwd CAXP Lottia gigantea from head, foo... 42 0.15 2 (FC737744) CBBH2566.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 42 0.15 2 (FC736921) CBBH1900.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 42 0.15 2 (FC763856) CBBN1420.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.15 2 (FC772881) CBBN7335.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.15 2 (FC760178) CBBN11918.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.15 2 (FC590815) CAXP6196.fwd CAXP Lottia gigantea from head, foot... 42 0.15 2 (FC636572) CAXU1620.fwd CAXU Lottia gigantea from female gon... 42 0.15 2 (FC770751) CBBN6032.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.15 2 (FC766745) CBBN3342.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.15 2 (FC762726) CBBN13473.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.15 2 (FC588370) CAXP4623.fwd CAXP Lottia gigantea from head, foot... 42 0.15 2 (FC758664) CBBN10892.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.15 2 (FC578601) CAXP13504.fwd CAXP Lottia gigantea from head, foo... 42 0.15 2 (FC737819) CBBH2622.fwd CBBH Lottia gigantea 26h,37h,61h Lar... 42 0.15 2 (FC647682) CAXU9220.fwd CAXU Lottia gigantea from female gon... 42 0.16 2 (FC773900) CBBN7990.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.16 2 (FC766393) CBBN3105.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.16 2 (FC575097) CAXP11498.fwd CAXP Lottia gigantea from head, foo... 42 0.16 2 (FC760124) CBBN11886.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.16 2 (FC768408) CBBN4399.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.16 2 (FC587907) CAXP4396.fwd CAXP Lottia gigantea from head, foot... 42 0.16 2 (FC766657) CBBN3278.fwd CBBN Lottia gigantea 3,4,5,6.5d Larv... 42 0.16 2 (FC646992) CAXU8771.fwd CAXU Lottia gigantea from female gon... 42 0.16 2 (FC577698) CAXP1300.fwd CAXP Lottia gigantea from head, foot... 42 0.16 2 (FC763947) CBBN14259.fwd CBBN Lottia gigantea 3,4,5,6.5d Lar... 42 0.16 2 (FC586780) CAXP3831.fwd CAXP Lottia gigantea from head, foot... 42 0.16 2
>(AU075930) Dictyostelium discoideum slug cDNA, clone SSA140. Length = 541
Score = 700 bits (353), Expect(3) = 0.0 Identities = 356/357 (99%) Strand = Plus / Plus
Query: 147 cagctgaattagctaatacacccagatggttaggtcaaaatccatcacaatcagaaatta 206 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 166 cagctgaattagctaatacactcagatggttaggtcaaaatccatcacaatcagaaatta 225
Query: 207 atgaaattttaagagaatttggaagtaataaccaaatgggagtggatggattatttaatt 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 226 atgaaattttaagagaatttggaagtaataaccaaatgggagtggatggattatttaatt 285
Query: 267 atttaggtagaaaagttgttgatgattttgatgaaaaagaaattattgaagctttccaag 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 286 atttaggtagaaaagttgttgatgattttgatgaaaaagaaattattgaagctttccaag 345
Query: 327 tatttgataaagatggtaaaggtatgatcggtgcttctgatcttagacatattttaacaa 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 346 tatttgataaagatggtaaaggtatgatcggtgcttctgatcttagacatattttaacaa 405
Query: 387 atttaggtgaaagattaccagaagaacaagtagaagaaatgttaagacaggcagtcggta 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 406 atttaggtgaaagattaccagaagaacaagtagaagaaatgttaagacaggcagtcggta 465
Query: 447 gtggtgatggtgcaatcaactatgaaccatttgtaagaaatatgttaaagaaataaa 503 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 466 gtggtgatggtgcaatcaactatgaaccatttgtaagaaatatgttaaagaaataaa 522
Score = 73.8 bits (37), Expect(3) = 0.0 Identities = 37/37 (100%) Strand = Plus / Plus
Query: 110 cattatatgatggaaataaagatggtaaattagaagc 146 ||||||||||||||||||||||||||||||||||||| Sbjct: 130 cattatatgatggaaataaagatggtaaattagaagc 166
Score = 42.1 bits (21), Expect(3) = 0.0 Identities = 21/21 (100%) Strand = Plus / Plus
Query: 73 gaagaagcacaatcagaattt 93 ||||||||||||||||||||| Sbjct: 96 gaagaagcacaatcagaattt 116
Score = 42.1 bits (21), Expect(2) = 0.41 Identities = 21/21 (100%) Strand = Plus / Plus
Query: 500 taaagaaataaaagaatccaa 520 ||||||||||||||||||||| Sbjct: 511 taaagaaataaaagaatccaa 531
Score = 28.2 bits (14), Expect(2) = 0.41 Identities = 14/14 (100%) Strand = Plus / Plus
Query: 125 ataaagatggtaaa 138 |||||||||||||| Sbjct: 352 ataaagatggtaaa 365
Lambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3 Number of Sequences: 102105510 Number of Hits to DB: 673,601,182 Number of extensions: 46028899 Number of successful extensions: 4393644 Number of sequences better than 10.0: 909 Length of query: 520 Length of database: 101,790,757,118 Length adjustment: 23 Effective length of query: 497 Effective length of database: 99,442,330,388 Effective search space: 49422838202836 Effective search space used: 49422838202836 X1: 11 (21.8 bits) S2: 22 (44.1 bits)
|