>VSG269 (VSG269Q) /CSM/VS/VSG2-C/VSG269Q.Seq.d/
GCCAAATCATATAAAATTATATTTTTTAATTTTATTTGTAAATAATTAATTTGTATTTTT
AAAAAAAAAAXXXXXXXXXX

PNHIKLYFLILFVNN*fvflkk---

Frame A:
aksykiiffnfick*licifkkk---


Frame B:
PNHIKLYFLILFVNN*fvflkk---


Frame C:
qii*nyif*fyl*iinlyf*kk---

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 0
Number of Sequences: 97611
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 80
length of database: 80,480,566
effective HSP length: 16
effective length of query: 64
effective length of database: 78,918,790
effective search space: 5050802560
effective search space used: 5050802560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

[blastall] WARNING:  [000.000]  SetUpBlastSearch failed.
[blastall] ERROR:  [000.000]  Blast: No valid letters to be indexed

ANTI-DNA BLAST search was processed by blast@nig.ac.jp, National Institute of Genetics, Japan.

 ***** No hits found ******

Lambda     K      H
   0.298    0.105    0.268

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3019103
Number of Hits to DB: 46,272,711

>VSG269F.Seq
GCCAAATCATATAAAATTATATTTTTTAATTTTATTTGTAAATAATTAATTTGTATTTTT
AAAAAAAAAA----------