VSF116
Library VS
(Link to library)
Clone ID VSF116
Atlas ID -
NBRP ID -
dictyBase ID -
Link to Contig -
Original site URL
Representative seq. ID VSF116F
(Link to Original site)
Representative DNA sequence
>VSF116 (VSF116Q) /CSM/VS/VSF1-A/VSF116Q.Seq.d/
AAAATAGATAACAAATAATAGTAACATATATATAAAATAAATAATTTTTTATTTACTAAT
TTTTTTTTTTTTTTTCTXXXXXXXXXX
sequence update 2001. 3.22
Translated Amino Acid sequence
kidnk***HIYKINNFLFTNFFFFF---


Translated Amino Acid sequence (All Frames)
Frame A:
kidnk***HIYKINNFLFTNFFFFF---


Frame B:
k*itnnsniyik*iifyllifffff---


Frame C:
nr*qiivtyi*nk*ffiy*fffff---


Homology vs CSM-cDNA

***** No hits found ******

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 0
Number of Sequences: 97611
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 87
length of database: 80,480,566
effective HSP length: 16
effective length of query: 71
effective length of database: 78,918,790
effective search space: 5603234090
effective search space used: 5603234090
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)








Dictyostelium discoideum cDNA Project Home



own update 2009. 4. 4
Homology vs DNA

***** No hits found ******

Lambda K H
1.37 0.711 1.31

[blastall] WARNING: [000.000] SetUpBlastSearch failed.
[blastall] ERROR: [000.000] Blast: No valid letters to be indexed

ANTI-DNA BLAST search was processed by blast@nig.ac.jp, National Institute of Genetics, Japan.








Dictyostelium discoideum cDNA Project Home



dna update 2003. 8.23
Homology vs Protein

***** No hits found ******

Lambda K H
0.318 0.134 0.401

Gapped
Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3268448
Number of Hits to DB: 40,249,574
protein update 2009. 7.31
PSORT -
5' end seq. ID VSF116F
5' end seq.
>VSF116F.Seq
AAAATAGATAACAAATAATAGTAACATATATATAAAATAAATAATTTTTTATTTACTAAT
TTTTTTTTTTTTTTTCT----------
Length of 5' end seq. 77
3' end seq. ID -
3' end seq. -
Length of 3' end seq. -
Connected seq. ID -
Connected seq. -
Length of connected seq. -
Full length Seq ID -
Full length Seq. -
Length of full length seq. -