VSD216
Library VS
(Link to library)
Clone ID VSD216
Atlas ID -
NBRP ID -
dictyBase ID -
Link to Contig -
Original site URL
Representative seq. ID VSD216F
(Link to Original site)
Representative DNA sequence
>VSD216 (VSD216Q) /CSM/VS/VSD2-A/VSD216Q.Seq.d/
ATTTTTATTNCAATTGAAATAAAAATATAAACATAAAAAATAAATAAATATATATAGGGT
TTTGCAGAGCAAAAAAAAAAXXXXXXXXXX
sequence update 2001. 3.22
Translated Amino Acid sequence
flxqlk*kykhkk*INIYRVLQSKKK---


Translated Amino Acid sequence (All Frames)
Frame A:
ifixieiki*t*kinkyi*gfaeqkk---


Frame B:
flxqlk*kykhkk*INIYRVLQSKKK---


Frame C:
fyxn*nkniniknk*iyigfcrakk---


Homology vs CSM-cDNA

***** No hits found ******

Lambda K H
1.37 0.711 1.31

Gapped
Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 36
Number of Sequences: 97611
Number of extensions: 36
Number of successful extensions: 11
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11
Number of HSP's gapped (non-prelim): 0
length of query: 90
length of database: 80,480,566
effective HSP length: 16
effective length of query: 74
effective length of database: 78,918,790
effective search space: 5839990460
effective search space used: 5839990460
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)








Dictyostelium discoideum cDNA Project Home



own update 2009. 4. 4
Homology vs DNA

***** No hits found ******

Lambda K H
1.37 0.711 1.31

Matrix: blastn matrix:1 -3
Number of Hits to DB: 79980
Number of Sequences: 25378875
Number of extensions: 79980
Number of successful extensions: 79747
Number of sequences better than 10.0: 0
length of query: 90
length of database: P,794,892,705
effective HSP length: 21
effective length of query: 69
effective length of database: P,261,936,330
effective search space: 2226073606770
effective search space used: 2226073606770
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

ANTI-DNA BLAST search was processed by blast@nig.ac.jp, National Institute of Genetics, Japan.








Dictyostelium discoideum cDNA Project Home



dna update 2003. 8.21
Homology vs Protein

***** No hits found ******

Lambda K H
0.318 0.134 0.401

Gapped
Lambda K H
0.267 0.0410 0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3268448
Number of Hits to DB: 47,233,325
protein update 2009. 7.29
PSORT -
5' end seq. ID VSD216F
5' end seq.
>VSD216F.Seq
ATTTTTATTNCAATTGAAATAAAAATATAAACATAAAAAATAAATAAATATATATAGGGT
TTTGCAGAGCAAAAAAAAAA----------
Length of 5' end seq. 80
3' end seq. ID -
3' end seq. -
Length of 3' end seq. -
Connected seq. ID -
Connected seq. -
Length of connected seq. -
Full length Seq ID -
Full length Seq. -
Length of full length seq. -