>SFC593 (SFC593Q) /CSM/SF/SFC5-D/SFC593Q.Seq.d/
XXXXXXXXXXCNTCATCATCATCATCATCATCATCATCATCATCATCNTCATCNTCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCNGTCNTCATCNTCATC
NAGCTCA

---XIIIIIIIIIIIXIXIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIXXHXHX
A

Frame A:
---XIIIIIIIIIIIXIXIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIXXHXHX
A


Frame B:
---sssssssssssssssssssssssssssssssssssssssssssssssssssvxixix
l


Frame C:
---hhhhhhhhhhhxhxhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhxssssss
s

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 0
Number of Sequences: 97611
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 0
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 0
length of query: 187
length of database: 80,480,566
effective HSP length: 17
effective length of query: 170
effective length of database: 78,821,179
effective search space: 13399600430
effective search space used: 13399600430
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)

 ***** No hits found ******

Lambda     K      H
    1.37    0.711     1.31

Matrix: blastn matrix:1 -3
Number of Hits to DB: 0
Number of Sequences: 30679270
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10.0: 0
length of query: 187
length of database: T,251,742,201
effective HSP length: 22
effective length of query: 165
effective length of database: S,576,798,261
effective search space: 5870171713065
effective search space used: 5870171713065
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
[blastall] WARNING:  [000.000]  1071944152.dbm.dna: Blast: No valid letters to be indexed on context 0

ANTI-DNA BLAST search was processed by blast@nig.ac.jp, National Institute of Genetics, Japan.

 ***** No hits found ******

Lambda     K      H
   0.318    0.134    0.401

Gapped
Lambda     K      H
   0.267   0.0410    0.140

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 3101297
Number of Hits to DB: 9,829,646

 psg: 1.01  gvh: 0.49  alm: -0.10  top: 0.53  tms: 0.13  mit: 0.32  mip: 0.00
 nuc: 0.00  erl: 0.00  erm: 0.00  pox: 0.00  px2: 0.00  vac: 0.00  rnp: 0.00
 act: 0.00  caa: 0.00  yqr: 0.00  tyr: 0.00  leu: 0.00  gpi: 0.00  myr: 0.00
 dna: 0.00  rib: 0.00  bac: 0.00  m1a: 0.00  m1b: 0.00  m2 : 0.00  mNt: 0.00
 m3a: 1.00  m3b: 0.00  m_ : 0.00 

	 32.0 %: endoplasmic reticulum
	 28.0 %: plasma membrane
	 20.0 %: mitochondrial
	  8.0 %: extracellular, including cell wall
	  4.0 %: Golgi
	  4.0 %: vacuolar
	  4.0 %: vesicles of secretory system

>> prediction for SFC593 is end

>SFC593Z.Seq
----------CNTCATCATCATCATCATCATCATCATCATCATCATCNTCATCNTCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCNGTCNTCATCNTCATC
NAGCTCA