DK963198 | |
Clone id | TST39A01NGRL0015_O06 |
Library | TST39 |
Length | 684 |
Definition | Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0015_O06. 5' end sequence. |
Accession | DK963198 |
Tissue type | prothallia with plantlets |
Developmental stage | gametophytes with sporophytes |
Contig ID | CL1836Contig1 |
Sequence | CGGGCATCATCATGAACCCCTCTCTACAAAAGGGCAGCCTTTCCATCATCTCTTTCTCCG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A4IYB1 |
Definition | sp|A4IYB1|MIAA_FRATW tRNA delta(2)-isopentenylpyrophosphate transferase OS=Francisella tularensis subsp. tularensis (strain WY96-3418) |
Align length | 100 |
Score (bit) | 32.0 |
E-value | 3.2 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |