DK956634 [AcEST]

DK956634
Clone id	TST39A01NGRL0026_E02
Library	TST39
Length	107
Definition	Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0026_E02. 5' end sequence.
Accession	DK956634
Tissue type	prothallia with plantlets
Developmental stage	gametophytes with sporophytes
Contig ID	-
Sequence	GTGCTATCAAGCGAAGTGTTAACAAATGGGGGGCGCTGCCAGGAAAGACTACGAGGAGGA GGCGGCGCCGCCGCCCACCTCCATAGCTGCCGCCTGCGCTGCTTCAA
■■Homology search results ■■	-
Swiss-Prot (release 56.9)	Link to BlastX Result : Swiss-Prot
sp_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= DK956634\|Adiantum capillus-veneris mRNA, clone: TST39A01NGRL0026_E02, 5' (107 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total letters Searching..................................................done *** No hits found ****
TrEMBL (release 39.9)	Link to BlastX Result : TrEMBL
tr_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= DK956634\|Adiantum capillus-veneris mRNA, clone: TST39A01NGRL0026_E02, 5' (107 letters) Database: uniprot_trembl.fasta 7,341,751 sequences; 2,391,615,440 total letters Searching..................................................done *** No hits found ****