DK949553 | |
Clone id | TST38A01NGRL0006_E18 |
Library | TST38 |
Length | 676 |
Definition | Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0006_E18. 5' end sequence. |
Accession | DK949553 |
Tissue type | prothallia |
Developmental stage | gametophyte |
Contig ID | - |
Sequence | TGCAATTAGAGAATTCTAGGACCAACCATTTCCTGAAAACCCTAATTTCGCGAGCGATAC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q09020 |
Definition | sp|Q09020|PR4_PHAVU Wound-induced basic protein OS=Phaseolus vulgaris |
Align length | 24 |
Score (bit) | 42.4 |
E-value | 0.002 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9PAC8 |
Definition | tr|A9PAC8|A9PAC8_POPTR Putative uncharacterized protein OS=Populus trichocarpa |
Align length | 24 |
Score (bit) | 42.4 |
E-value | 0.027 |
Report | BLASTX 2.2.19 [Nov-02-2008] |