BP920046 | |
Clone id | YMU001_000132_D09 |
Library | YMU01 |
Length | 477 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000132_D09. |
Accession | BP920046 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL809Contig1 |
Sequence | TGTACTTGTACAATCCAAGCATGCCTTGTGCCGATCATTCTTGCTCAGTGAAAGGGTGTC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q8VD00 |
Definition | sp|Q8VD00|TMM97_MOUSE Transmembrane protein 97 OS=Mus musculus |
Align length | 33 |
Score (bit) | 33.5 |
E-value | 0.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |