BP917285 | |
Clone id | YMU001_000098_G04 |
Library | YMU01 |
Length | 112 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000098_G04. |
Accession | BP917285 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GAAGGTCTCTCGGAAGCAGTGAAAAAAGAGCAAAATGGTATACTTTGCACAATTAGGAGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot(No blast op. Sequence too short.) |
sp_hit_id | - |
Definition | - |
Align length | - |
Score (bit) | - |
E-value | - |
Report | - |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL(No blast op. Sequence too short.) |
tr_hit_id | - |
Definition | - |
Align length | - |
Score (bit) | - |
E-value | - |
Report | - |