| BP917050 | |
| Clone id | YMU001_000095_C09 |
| Library | YMU01 |
| Length | 64 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000095_C09. |
| Accession | BP917050 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GGTGATAGAAAGACATACTTCTGTCCCTTTGTATTGATGGGGTCATTCCAATAAGCCAGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot(No blast op. Sequence too short.) |
| sp_hit_id | - |
| Definition | - |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | - |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL(No blast op. Sequence too short.) |
| tr_hit_id | - |
| Definition | - |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | - |