BP916380 | |
Clone id | YMU001_000087_A11 |
Library | YMU01 |
Length | 510 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000087_A11. |
Accession | BP916380 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TCCACACTACAAACGCCATGATCAAGATTATTAAGTAATAATAAGAATTGGCTTGGAACA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9FQ19 |
Definition | sp|Q9FQ19|SCC13_ARATH Sister chromatid cohesion 1 protein 3 OS=Arabidopsis thaliana |
Align length | 39 |
Score (bit) | 31.6 |
E-value | 2.2 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A5X2L2 |
Definition | tr|A5X2L2|A5X2L2_9MUSC Carbamoylphosphate synthetase (Fragment) OS=Chelifera sp. JKM-2006 |
Align length | 80 |
Score (bit) | 33.1 |
E-value | 8.1 |
Report | BLASTX 2.2.19 [Nov-02-2008] |